National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7375R-2 
 Symbol CG7375  Full Name CG7375 
 CG No CG7375  Old CG No CG7375 
 Synonyms anon-WO0118547.309, CG7375 
 Accession No (Link to NCBI) NM_139930.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Strutt H, Searle E, Thomas-Macarthur V, Brookfield R, Strutt D.
A Cul-3-BTB ubiquitylation pathway regulates junctional levels and asymmetry of core planar polarity proteins.
Development (2013) 140(8) 1693-702 [ PubMed ID = 23487316 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   TATTCACGCTTAAGCAGCAGAAGAAAGACGGCGAGCAAAAGGGCAGTCAGCAGAAGAAA 59

                          |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCGTCCGCCGCCCAGCTGCGCATACAGAAAGATATTAACGAACTGAACCTGCCAAACACT 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGCGCCACAGACTTTCCCGATCCCAATGACTTGCTCAACTTCAAGCTTATCATCTCGCCC 179

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GACGAGGGCTTCTACAGAGACGGGCGCTTCGTGTTCAATTTCCGCGTCGGATCCAACTAT 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCGCACGAGCCGCCCAAGGTGAAGTGCGCCACCCAGGTGTACCATCCCAATATTGACCTG 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GATGGCAACGTCTGCCTCAACATTCTGCGCGAGGACTGGAATCCAGTGCTGAACATCAAC 359

                          |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| silico     361 TCCATCGTCTATGGCTTGCAGTTTCTATTCTTGG-AACCCAATCCCGAGGATCCGC-TCA 419

                          |||| ||||||||||||| |||| ||||| |||||||||  ||||||||  |||| |||| silico     421 ACAA-GGAGGCGGCCGAC-GTCC-TGCAG-ACCAACCGC--CGTCAGTT--CGAG-AACA 479

                          |  ||||||||||| |||||||||||||||| silico     481 A--TGTAAAGAAGGCGATGCGTGGTGGCTGT 510

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.