National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7366R-4 
 Symbol CG7366  Full Name CG7366 
 CG No CG7366  Old CG No CG7366 
 Synonyms anon-WO0140519.185, CG7366 
 Accession No (Link to NCBI) NM_139932.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTGCGCAGCCTGCAGTTGTATTCCAAGGAGCACCCTGTCAGCCAAGATGACCACGACATA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGTCAGCGTTGGATGCAGCACTTCCAAAACGCCAAGGGTTTGGATAAATTCGCACGAAAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGCATGCTGCTGATGATGTGCGAACAGTTGCGAGATCTTGGCCACTTGAGCAAACCCTTC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACCGAACTGAAGAACTTGAGTCGCCCCATGGACGATTTGCTGAACGAGTACCATGGGACG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACTACTGTGGAGGAGGGGCAAATGTCGCCGGTTGAAGATATTGAGGACTCGGACACCAAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GTCTCCAACTATGGCAGTGGCAGTAGTTCTTTCTCCCCTGGGGTGCCCTATCCCATTTCC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACGCCCGAGTTCGAGAGCATTAAGCGGTCTAACCAGGATCTGCTTAAGGAAATCGACTCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTGCACTGTCGCACGGTGGAAGCGGAAAAGCTATACCTTAGCAGGAGCCAAATTCTGGAG 480

7366R-4.IR_full       481 AAGCAGATTGCCGAGAAGTC 500
                          |||||||||||||||||||| silico     481 AAGCAGATTGCCGAGAAGTC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139932.2  CG7366-RA (CG7366), mRNA 
0   NM_132159.1  CG1677-RA (CG1677), mRNA 
0   NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_141277.2  CG1172-RA (CG1172), mRNA 
0   NM_080292.2  CG3972-RA (Cyp4g1), mRNA 
0   NM_135529.2  CG5395-RA (nmd), mRNA 
0   NM_144182.1  CG14162-RA (dpr6), mRNA 
0   NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   NM_057640.2  CG17769-RA (And), mRNA 
0   NM_164659.1  CG11142-RB, transcript variant B (CG11142), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_170468.1  CG31029-RA (CG31029), mRNA 
0   NM_142047.1  CG9351-RA, transcript variant A (flfl), mRNA 
0   NM_169548.1  CG9351-RB, transcript variant B (flfl), mRNA 
0   NM_169549.1  CG9351-RC, transcript variant C (flfl), mRNA 
0   NM_176242.1  CG33133-RA (grau), mRNA 
0   NM_057736.3  CG4832-RA, transcript variant A (cnn), mRNA 
0   NM_001038855.1  CG4832-RE, transcript variant E (cnn), mRNA 
0   NM_165990.1  CG4832-RB, transcript variant B (cnn), mRNA 
0   NM_001014523.1  CG4832-RD, transcript variant D (cnn), mRNA 
0   NM_165991.1  CG4832-RC, transcript variant C (cnn), mRNA 
0   NM_001038780.1  CG33979-RA, transcript variant A (capt), mRNA 
0   NM_078519.1  CG1430-RA (bys), mRNA 
0   NM_167762.2  CG17450-RA, transcript variant A (CG17450), mRNA 
0   NM_167761.2  CG17450-RB, transcript variant B (CG17450), mRNA 
0   NM_167767.1  CG32819-RA, transcript variant A (CG32819), mRNA 
0   NM_167768.1  CG32819-RB, transcript variant B (CG32819), mRNA 
0   NM_167764.2  CG32820-RA, transcript variant A (CG32820), mRNA 
0   NM_167765.2  CG32820-RB, transcript variant B (CG32820), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.