National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7365R-2 
 Symbol CG7365  Full Name CG7365 
 CG No CG7365  Old CG No CG7365 
 Synonyms CG7365 
 Accession No (Link to NCBI) NM_140921.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees abnormal wing 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCTTTGGCCTGCTCTTCCTG 
 Primer Seq. 3'
aatctagaggtaccTCCGTCGAGATGCCGTCCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCTTTGGCC TGCTCTTCCT GCTCGCTTTC GGCCATGTGA CGTCACAGCG CACGTCACTG 
0061 GACGTGGCTC TGAAGAACGT CTACAGACCG CTGCGACTTC TGGGCCTGGC CTTTACCGGT 
0121 CGATCTGGCG ACGATCCACA AAACGTGCAG CGCTTACAAA TCGCGGGGAA AACACAAAAG 
0181 TCGAACCCCC GCACTCGAGC CCTGCTGGAG TTCTGCGATG CGGACCACGG ACCCGGAAAG 
0241 AGGAGCCCGG AGCGACCCAC CAGTGTGCAT CGCNTTGCGA CCCGGTGACA TCGATGTGAT 
0301 CGGAGCAATG GGTGACTCGC TGACCGCCGG AANACGGCAT NATTTGCCAC AAACTTACTG 
0361 CATGTGACCG TGGAGAACAG GGGCGTGGTG TGGTCCATTG GGGGGCAGTA CGACTGGAGG 
0421 AAGTACTTGA CGTTGCCAAA CATCTTGAAG GAGTTCAATC CCAAACTGTA CGGCTATGCG 
0481 ATCAAGGACG GCATCTCAAC GGA 
 in silico PCR Fragment
0001 TGCTTTGGCC TGCTCTTCCT GCTCGCTTTC GGCCATGTGA CGTCACAGCG CACGTCACTG 
0061 GACGTGGCTC TGAAGAACGT CTACAGACCG CTGCGACTTC TGGGCCTGGC CTTTACCGGT 
0121 CGATCTGGCG ACGATCCACA AAACGTGCAG CGCTTACAAA TCGCGGGGAA AACACAAAAG 
0181 TCGAACCCCC GCACTCGAGC CCTGCTGGAG TTCTGCGATG CGGACCACGG ACCCGGAAAG 
0241 AGGAGCCCGG AGCGACCCAC CAGTGTGCAT CGC-TTGCGA CCCGGTGACA TCGATGTGAT 
0301 CGGAGCAATG GGTGACTCGC TGACCGCCGG AA-ACGGCAT -ATTTGCCAC AAACTTACTG 
0361 CATGTGACCG TGGAGAACAG GGGCGTGGTG TGGTCCATTG GGGGGCAGTA CGACTGGAGG 
0421 AAGTACTTGA CGTTGCCAAA CATCTTGAAG GAGTTCAATC CCAACCTGTA CGGCTATGCG 
0481 ATCAAGGACG GCATCTCGAC GGA 
 Assemble Data

7365R-2.IR_full       1   TGCTTTGGCCTGCTCTTCCTGCTCGCTTTCGGCCATGTGACGTCACAGCGCACGTCACTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7365R-2.in silico     1   TGCTTTGGCCTGCTCTTCCTGCTCGCTTTCGGCCATGTGACGTCACAGCGCACGTCACTG 60


7365R-2.IR_full       61  GACGTGGCTCTGAAGAACGTCTACAGACCGCTGCGACTTCTGGGCCTGGCCTTTACCGGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7365R-2.in silico     61  GACGTGGCTCTGAAGAACGTCTACAGACCGCTGCGACTTCTGGGCCTGGCCTTTACCGGT 120


7365R-2.IR_full       121 CGATCTGGCGACGATCCACAAAACGTGCAGCGCTTACAAATCGCGGGGAAAACACAAAAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7365R-2.in silico     121 CGATCTGGCGACGATCCACAAAACGTGCAGCGCTTACAAATCGCGGGGAAAACACAAAAG 180


7365R-2.IR_full       181 TCGAACCCCCGCACTCGAGCCCTGCTGGAGTTCTGCGATGCGGACCACGGACCCGGAAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7365R-2.in silico     181 TCGAACCCCCGCACTCGAGCCCTGCTGGAGTTCTGCGATGCGGACCACGGACCCGGAAAG 240


7365R-2.IR_full       241 AGGAGCCCGGAGCGACCCACCAGTGTGCATCGCNTTGCGACCCGGTGACATCGATGTGAT 300
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
7365R-2.in silico     241 AGGAGCCCGGAGCGACCCACCAGTGTGCATCGC-TTGCGACCCGGTGACATCGATGTGAT 300


7365R-2.IR_full       301 CGGAGCAATGGGTGACTCGCTGACCGCCGGAANACGGCATNATTTGCCACAAACTTACTG 360
                          |||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||
7365R-2.in silico     301 CGGAGCAATGGGTGACTCGCTGACCGCCGGAA-ACGGCAT-ATTTGCCACAAACTTACTG 360


7365R-2.IR_full       361 CATGTGACCGTGGAGAACAGGGGCGTGGTGTGGTCCATTGGGGGGCAGTACGACTGGAGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7365R-2.in silico     361 CATGTGACCGTGGAGAACAGGGGCGTGGTGTGGTCCATTGGGGGGCAGTACGACTGGAGG 420


7365R-2.IR_full       421 AAGTACTTGACGTTGCCAAACATCTTGAAGGAGTTCAATCCCAAACTGTACGGCTATGCG 480
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
7365R-2.in silico     421 AAGTACTTGACGTTGCCAAACATCTTGAAGGAGTTCAATCCCAACCTGTACGGCTATGCG 480


7365R-2.IR_full       481 ATCAAGGACGGCATCTCAACGGA 503
                          ||||||||||||||||| |||||
7365R-2.in silico     481 ATCAAGGACGGCATCTCGACGGA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140921.2  CG7365-RA (CG7365), mRNA 
0.2   NM_140296.2  CG5642-RA (CG5642), mRNA 
0   NM_132217.2  CG10958-RA (CG10958), mRNA 
0   NM_132373.2  CG15312-RA, transcript variant A (CG15312), mRNA 
0   NM_167216.1  CG15312-RC, transcript variant C (CG15312), mRNA 
0   NM_167215.1  CG15312-RB, transcript variant B (CG15312), mRNA 
0   NM_176347.1  CG18135-RC, transcript variant C (CG18135), mRNA 
0   NM_078864.2  CG13281-RA (Cas), mRNA 
0   NM_140761.2  CG7441-RA (CG7441), mRNA 
0   NM_138193.1  CG17180-RA (CG17180), mRNA 
0   NM_079501.2  CG1058-RA (rpk), mRNA 
0   NM_132905.2  CG9902-RA (CG9902), mRNA 
0   NM_142974.2  CG17786-RA (CG17786), mRNA 
0   NM_206194.1  CG15669-RK, transcript variant K (MESK2), mRNA 
0   NM_166456.2  CG15669-RC, transcript variant C (MESK2), mRNA 
0   NM_079259.2  CG4974-RA (dally), mRNA 
0   NM_132909.1  CG9782-RA (CG9782), mRNA 
0   NM_143184.1  CG5959-RA (CG5959), mRNA 
0   NM_001038809.1  CG17139-RA, transcript variant A (CG17139), mRNA 
0   NM_001038808.1  CG17140-RA, transcript variant A (CG17140), mRNA 
0   NM_136987.2  CG13321-RA (CG13321), mRNA 
0   NM_079931.3  CG9580-RA (Sdic:CG9580), mRNA 
0   NM_057722.3  CG18000-RG, transcript variant G (sw), mRNA 
0   NM_057724.3  CG18000-RI, transcript variant I (sw), mRNA 
0   NM_057730.4  CG18000-RE, transcript variant E (sw), mRNA 
0   NM_057723.3  CG18000-RH, transcript variant H (sw), mRNA 
0   NM_057726.3  CG18000-RA, transcript variant A (sw), mRNA 
0   NM_057729.3  CG18000-RB, transcript variant B (sw), mRNA 
0   NM_206796.1  CG33499-RA (Sdic:CG33499), mRNA 
0   NM_057728.3  CG18000-RC, transcript variant C (sw), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.