National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7364R-2 
 Symbol CG7364  Full Name CG7364 
 CG No CG7364  Old CG No CG7364 
 Synonyms n(2)k07245, BG:DS00797.1, CG16861, CG7364 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCTGGCTAGGCCATGTCTGG 
 Primer Seq. 3'
aatctagaggtaccCGTCCACTTGGCCTAGACGAT 
 Predicted Fragment Size
495 
 IR fragment full Seq
0001 CTCTGGCTAG GNCATGTCTG GCGATAGTCC TGCTGGCGGG CGTCGTCCTG GTGGCCGACT 
0061 CCTTCTACGT GCCCGGCGTG GCGCCGGTGG AGTTCGTACA AGACCAAAAG ATCGACGTGA 
0121 AAACCGTGAA GATGACTAGC AGCCGCACCC AGCTGCCATA TCAGTACTAC TCTCTTAGGT 
0181 TCTGCTATCC CAAGAATGGC ACGCTCATCT TTAAGTCAGA GAATTTGGGT GAAGTTCTGC 
0241 GCGGCGACCG AATCGTCAAT ACGCCTTACG AGGTGCGGAT GAACCAGCAG GTCAACTGCC 
0301 GGCTGTTGTG CAACCAGAAG GACAGACCGC TCACTTGGAG TAAAGAGGAC TCCGCACTGG 
0361 TTGCGANGCG CATCCAGCAC GAGTACTTTG TGCATCTGCT CGTGGACAAT CTGCCGGTGN 
0421 CCACGCGCAT CGTCAGCGTT AACAATCCCG CGGAGGTGAC CTACGAGCAC GGGTATCGTC 
0481 TAGGCCAAGT GGACG 
 in silico PCR Fragment
0001 CTCTGGCTAG GCCATGTCTG GCGATAGTCC TGCTGGCGGG CGTCGTCCTG GTGGCCGACT 
0061 CCTTCTACGT GCCCGGCGTG GCGCCGGTGG AGTTCGTACA AGACCAAAAG ATCGACGTGA 
0121 AAGCCGTGAA GATGACTAGC AGCCGCACCC AGCTGCCATA TCAGTACTAC TCTCTTAGGT 
0181 TCTGCTATCC CAAGAATGGC ACGCTCATCT TTAAGTCAGA GAATTTGGGT GAAGTTCTGC 
0241 GCGGCGACCG AATCGTCAAT ACGCCTTACG AGGTGCGGAT GAACCAGCAG GTCAACTGCC 
0301 GGCTGTTGTG CAACCAGAAG GACAGACCGC TCACTTGGAG TAAAGAGGAC TCCGCACTGG 
0361 TTGCGGAGCG CATCCAGCAC GAGTACTTTG TGCATCTGCT CGTGGACAAT CTGCCGGTGG 
0421 CCACGCGCAT CGTCAGCGTT AACAATCCCG CGGAGGTGAC CTACGAGCAC GGGTATCGTC 
0481 TAGGCCAAGT GGACG 
 Assemble Data

7364R-2.IR full       1   CTCTGGCTAGGNCATGTCTGGCGATAGTCCTGCTGGCGGGCGTCGTCCTGGTGGCCGACT 60
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
7364R-2.in silico     1   CTCTGGCTAGGCCATGTCTGGCGATAGTCCTGCTGGCGGGCGTCGTCCTGGTGGCCGACT 60


7364R-2.IR full       61  CCTTCTACGTGCCCGGCGTGGCGCCGGTGGAGTTCGTACAAGACCAAAAGATCGACGTGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7364R-2.in silico     61  CCTTCTACGTGCCCGGCGTGGCGCCGGTGGAGTTCGTACAAGACCAAAAGATCGACGTGA 120


7364R-2.IR full       121 AAACCGTGAAGATGACTAGCAGCCGCACCCAGCTGCCATATCAGTACTACTCTCTTAGGT 180
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7364R-2.in silico     121 AAGCCGTGAAGATGACTAGCAGCCGCACCCAGCTGCCATATCAGTACTACTCTCTTAGGT 180


7364R-2.IR full       181 TCTGCTATCCCAAGAATGGCACGCTCATCTTTAAGTCAGAGAATTTGGGTGAAGTTCTGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7364R-2.in silico     181 TCTGCTATCCCAAGAATGGCACGCTCATCTTTAAGTCAGAGAATTTGGGTGAAGTTCTGC 240


7364R-2.IR full       241 GCGGCGACCGAATCGTCAATACGCCTTACGAGGTGCGGATGAACCAGCAGGTCAACTGCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7364R-2.in silico     241 GCGGCGACCGAATCGTCAATACGCCTTACGAGGTGCGGATGAACCAGCAGGTCAACTGCC 300


7364R-2.IR full       301 GGCTGTTGTGCAACCAGAAGGACAGACCGCTCACTTGGAGTAAAGAGGACTCCGCACTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7364R-2.in silico     301 GGCTGTTGTGCAACCAGAAGGACAGACCGCTCACTTGGAGTAAAGAGGACTCCGCACTGG 360


7364R-2.IR full       361 TTGCGANGCGCATCCAGCACGAGTACTTTGTGCATCTGCTCGTGGACAATCTGCCGGTGN 420
                          |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||| 
7364R-2.in silico     361 TTGCGGAGCGCATCCAGCACGAGTACTTTGTGCATCTGCTCGTGGACAATCTGCCGGTGG 420


7364R-2.IR full       421 CCACGCGCATCGTCAGCGTTAACAATCCCGCGGAGGTGACCTACGAGCACGGGTATCGTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7364R-2.in silico     421 CCACGCGCATCGTCAGCGTTAACAATCCCGCGGAGGTGACCTACGAGCACGGGTATCGTC 480


7364R-2.IR full       481 TAGGCCAAGTGGACG 495
                          |||||||||||||||
7364R-2.in silico     481 TAGGCCAAGTGGACG 495

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.