National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7363R-3 
 Symbol w-cup  Full Name world cup 
 CG No CG7363  Old CG No CG7363 
 Synonyms CG7363, BcDNA:AT31112, w-cup 
 Accession No (Link to NCBI) NM_135579.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGCTTACCATTGAGAATGCCCGAAAATCAAAGCAATTAATTGCAGAAGAAACGTTAAATA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTCCCAAAGAAGAAAGCTCAAATGTCGTGGAAAATTTACCAAGCTCACCAGAAAAACCAG 120

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TAAAGGAAGAAGTTCAAGAAGCCAAGGAACAGGATACCATCATACCGCAATCCGAGGAAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGAAAATCGAAAAACTGGATCAAATGGAGGCAAGTACTTCATCGGCAGCTCAGGAGGCGG 240

                          ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| | silico     241 AAATGAAAAAGCCAAACGAAGTGAT-GCCTGGCAAAGAGGAATACATTGACCCAAGGG-A 300

                          ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AAAAATCAG-GAAGGACATGGAAGAATATTTTAGTGGCATTCAGGCTCTGGAGGTCAAGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGACAATTCGCGACGAGCTGAGTGCAAAGGAAGGTGAAGTCATTTTAAGAGAGGATCAGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAAAGAAAACCTGGAAGGGAATGCTTCTATCAGTGACCCACACAACCTTATCTACATCTA 480

7363R-3.IR_full       481 CTAGTCACAGCACATCTTCGGGT 503
                          ||||||||||||||||||||||| silico     481 CTAGTCACAGCACATCTTCGGGT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135579.2  CG7363-RA (w-cup), mRNA 
0   NM_138147.2  CG2736-RA (CG2736), mRNA 
0   NM_168292.1  CG5939-RD, transcript variant D (Prm), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 
0   NM_057357.2  CG1569-RA (rod), mRNA 
0   NM_142889.1  CG4374-RA (CG4374), mRNA 
0   NM_057539.3  CG9310-RA, transcript variant A (Hnf4), mRNA 
0   NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 
0   NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
0   49  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_143391.1  CG11828-RA (CG11828), mRNA 
0   NM_138259.2  CG9165-RA (l(3)02640), mRNA 
0   NM_079636.2  CG4898-RA, transcript variant A (Tm1), mRNA 
0   NM_206494.1  CG4898-RL, transcript variant L (Tm1), mRNA 
0   NM_135867.2  CG7516-RA (CG7516), mRNA 
0   NM_001014649.1  CG5695-RD, transcript variant D (jar), mRNA 
0   NM_001014648.1  CG5695-RE, transcript variant E (jar), mRNA 
0   NM_001014647.1  CG5695-RF, transcript variant F (jar), mRNA 
0   NM_170138.1  CG5695-RB, transcript variant B (jar), mRNA 
0   NM_001014650.1  CG5695-RC, transcript variant C (jar), mRNA 
0   NM_079754.2  CG5695-RA, transcript variant A (jar), mRNA 
0   NM_140395.1  CG10116-RA (CG10116), mRNA 
0   NM_168387.1  CG6711-RA (Taf2), mRNA 
0   NM_140112.1  CG14165-RA (CG14165), mRNA 
0   NM_143719.2  CG12396-RA (Nnp-1), mRNA 
0   13  NM_167505.1  CG4211-RB, transcript variant B (nonA), mRNA 
0   10  NM_078643.2  CG4211-RA, transcript variant A (nonA), mRNA 
0   10  NM_001014747.1  CG4211-RC, transcript variant C (nonA), mRNA 
0   NM_176426.2  CG31349-RF, transcript variant F (pyd), mRNA 
0   NM_057349.4  CG31349-RB, transcript variant B (pyd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.