National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7363R-2 
 Symbol w-cup  Full Name world cup 
 CG No CG7363  Old CG No CG7363 
 Synonyms CG7363, BcDNA:AT31112, w-cup 
 Accession No (Link to NCBI) NM_135579.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCTTACCATTGAGAATGCCC 
 Primer Seq. 3'
aatctagaggtaccACCCGAAGATGTGCTGTGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCTTACCAT TGAGAATGCC CGAAAATCAA AGCAATTAAT TGCAGAAGAA ACGTTAAATA 
0061 GTCCCAAAGA AGAAAGCTCA AATGTCGTGG AAAATTTACC AAGCTCACCA GAAAAACCAG 
0121 TAAAGGAAGA ABTTCAAGAA GCCAAGGAAC AGGATACCAT CATACCGCAA TCCGAGGAAG 
0181 TGAAAATCGA AAAACTGGAT CAAATGGAGG CAAGTACTTC ATCGGCAGCT CAGGAGGCGG 
0241 AAATGAAAAA GCCAAACGAA GTGATNGCCC GGCAAAGAGG AATACATTGA CCCAAGGGAA 
0301 AAAAATCAGC GAAGGACATG GAAGAATATT TTAGTGGCAT TCAGGCTCTG GAGGTCAAGA 
0361 AGACAATTCG CGACGAGCTG AGTGCAAAGG AAGGTGAAGT CATTTTAAGA GAGGATCAGC 
0421 GAAAGAAAAC CTGGAAGGGA ATGCTTCTAT CAGTGACCCA CACAACCTTA TCTACATCTA 
0481 CTAGTCACAG CACATCTTCG GGT 
 in silico PCR Fragment
0001 CGCTTACCAT TGAGAATGCC CGAAAATCAA AGCAATTAAT TGCAGAAGAA ACGTTAAATA 
0061 GTCCCAAAGA AGAAAGCTCA AATGTCGTGG AAAATTTACC AAGCTCACCA GAAAAACCAG 
0121 TAAAGGAAGA AGTTCAAGAA GCCAAGGAAC AGGATACCAT CATACCGCAA TCCGAGGAAG 
0181 TGAAAATCGA AAAACTGGAT CAAATGGAGG CAAGTACTTC ATCGGCAGCT CAGGAGGCGG 
0241 AAATGAAAAA GCCAAACGAA GTGAT-GCCT GGCAAAGAGG AATACATTGA CCCAAGGG-A 
0301 AAAAATCAG- GAAGGACATG GAAGAATATT TTAGTGGCAT TCAGGCTCTG GAGGTCAAGA 
0361 AGACAATTCG CGACGAGCTG AGTGCAAAGG AAGGTGAAGT CATTTTAAGA GAGGATCAGC 
0421 GAAAGAAAAC CTGGAAGGGA ATGCTTCTAT CAGTGACCCA CACAACCTTA TCTACATCTA 
0481 CTAGTCACAG CACATCTTCG GGT 
 Assemble Data

7363R-2.IR_full       1   CGCTTACCATTGAGAATGCCCGAAAATCAAAGCAATTAATTGCAGAAGAAACGTTAAATA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7363R-2.in silico     1   CGCTTACCATTGAGAATGCCCGAAAATCAAAGCAATTAATTGCAGAAGAAACGTTAAATA 60


7363R-2.IR_full       61  GTCCCAAAGAAGAAAGCTCAAATGTCGTGGAAAATTTACCAAGCTCACCAGAAAAACCAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7363R-2.in silico     61  GTCCCAAAGAAGAAAGCTCAAATGTCGTGGAAAATTTACCAAGCTCACCAGAAAAACCAG 120


7363R-2.IR_full       121 TAAAGGAAGAABTTCAAGAAGCCAAGGAACAGGATACCATCATACCGCAATCCGAGGAAG 180
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
7363R-2.in silico     121 TAAAGGAAGAAGTTCAAGAAGCCAAGGAACAGGATACCATCATACCGCAATCCGAGGAAG 180


7363R-2.IR_full       181 TGAAAATCGAAAAACTGGATCAAATGGAGGCAAGTACTTCATCGGCAGCTCAGGAGGCGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7363R-2.in silico     181 TGAAAATCGAAAAACTGGATCAAATGGAGGCAAGTACTTCATCGGCAGCTCAGGAGGCGG 240


7363R-2.IR_full       241 AAATGAAAAAGCCAAACGAAGTGATNGCCCGGCAAAGAGGAATACATTGACCCAAGGGAA 300
                          ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
7363R-2.in silico     241 AAATGAAAAAGCCAAACGAAGTGAT-GCCTGGCAAAGAGGAATACATTGACCCAAGGG-A 300


7363R-2.IR_full       301 AAAAATCAGCGAAGGACATGGAAGAATATTTTAGTGGCATTCAGGCTCTGGAGGTCAAGA 360
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
7363R-2.in silico     301 AAAAATCAG-GAAGGACATGGAAGAATATTTTAGTGGCATTCAGGCTCTGGAGGTCAAGA 360


7363R-2.IR_full       361 AGACAATTCGCGACGAGCTGAGTGCAAAGGAAGGTGAAGTCATTTTAAGAGAGGATCAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7363R-2.in silico     361 AGACAATTCGCGACGAGCTGAGTGCAAAGGAAGGTGAAGTCATTTTAAGAGAGGATCAGC 420


7363R-2.IR_full       421 GAAAGAAAACCTGGAAGGGAATGCTTCTATCAGTGACCCACACAACCTTATCTACATCTA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7363R-2.in silico     421 GAAAGAAAACCTGGAAGGGAATGCTTCTATCAGTGACCCACACAACCTTATCTACATCTA 480


7363R-2.IR_full       481 CTAGTCACAGCACATCTTCGGGT 503
                          |||||||||||||||||||||||
7363R-2.in silico     481 CTAGTCACAGCACATCTTCGGGT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135579.2  CG7363-RA (w-cup), mRNA 
0   NM_138147.2  CG2736-RA (CG2736), mRNA 
0   NM_168292.1  CG5939-RD, transcript variant D (Prm), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 
0   NM_057357.2  CG1569-RA (rod), mRNA 
0   NM_142889.1  CG4374-RA (CG4374), mRNA 
0   NM_057539.3  CG9310-RA, transcript variant A (Hnf4), mRNA 
0   NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 
0   NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
0   49  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_143391.1  CG11828-RA (CG11828), mRNA 
0   NM_138259.2  CG9165-RA (l(3)02640), mRNA 
0   NM_079636.2  CG4898-RA, transcript variant A (Tm1), mRNA 
0   NM_206494.1  CG4898-RL, transcript variant L (Tm1), mRNA 
0   NM_135867.2  CG7516-RA (CG7516), mRNA 
0   NM_001014649.1  CG5695-RD, transcript variant D (jar), mRNA 
0   NM_001014648.1  CG5695-RE, transcript variant E (jar), mRNA 
0   NM_001014647.1  CG5695-RF, transcript variant F (jar), mRNA 
0   NM_170138.1  CG5695-RB, transcript variant B (jar), mRNA 
0   NM_001014650.1  CG5695-RC, transcript variant C (jar), mRNA 
0   NM_079754.2  CG5695-RA, transcript variant A (jar), mRNA 
0   NM_140395.1  CG10116-RA (CG10116), mRNA 
0   NM_168387.1  CG6711-RA (Taf2), mRNA 
0   NM_140112.1  CG14165-RA (CG14165), mRNA 
0   NM_143719.2  CG12396-RA (Nnp-1), mRNA 
0   13  NM_167505.1  CG4211-RB, transcript variant B (nonA), mRNA 
0   10  NM_078643.2  CG4211-RA, transcript variant A (nonA), mRNA 
0   10  NM_001014747.1  CG4211-RC, transcript variant C (nonA), mRNA 
0   NM_176426.2  CG31349-RF, transcript variant F (pyd), mRNA 
0   NM_057349.4  CG31349-RB, transcript variant B (pyd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.