National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7361R-1 
 Symbol RFeSP  Full Name Rieske iron-sulfur protein 
 CG No CG7361  Old CG No CG7361 
 Synonyms RfeSP, CG7361, H, l(2)k11704, anon-EST:Posey219, RFeSP 
 Accession No (Link to NCBI) NM_080009.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAACGCCGTGTCGCGTGCTTA 
 Primer Seq. 3'
aatctagaggtaccACATCATCAGCCTCCGGATCG 
 Predicted Fragment Size
471 
 IR fragment full Seq
0001 NAACGCCGTG TCGCGTGCTT ACGTCAGAGG CggAGCCNAG NGTCCTCTCC ACGGGATTGA 
0061 AGGCGAGCGG CGTGGCcgTC AACTCGATGG CCAATCGCCA GGCACACACC GACCTGCAGG 
0121 TGCCAGACTT CTCGGCATAC CGCCGGGAGT CCGTGAAGGA CANTCGTCGT CGCAACGACA 
0181 CCGCCGAGGA GCGCAAGGCC TTCTCCTACT TGATGGTCGG CGCCGGANCC GTgGGCGGTG 
0241 CCTATGCNGC CAAGGGCCTG GNTTAACACC TTCATCGGAT CGATGAGCGC CTCCGCCGAA 
0301 GTNCTGGNCA TGGCCAAGAT CGAGATCAAG CTGTCCGACA TCCCGGAGGG CAAGTCGGTT 
0361 ACTTTCAAGT GGCGCGGAAA GCCCCTGTTC ATCCGCCAcC GCACGGCCGC GGAAATCGAG 
0421 ACCGAGCGAA ATGTGCCCAC ATccNCNCTN CGCGATCCGG AGGCTGATGA TGT 
 in silico PCR Fragment
0001 GAACGCCGTG TCGCGTGCTT ACGTCAGAGG CGGAGCCCAG -GTCCTCTCC ACGGGATTGA 
0061 AGGCGAGCGG CGTGGCCGTC AACTCGATGG CCAATCGCCA GGCACACACC GACCTGCAGG 
0121 TGCCAGACTT CTCGGCATAC CGCCGGGAGT CCGTGAAGGA CAGTCGTCGT CGCAACGACA 
0181 CCGCCGAGGA GCGCAAGGCC TTCTCCTACT TGATGGTCGG CGCCGGAGCC GTGGGCGGTG 
0241 CCTATGCGGC CAAGGGCCTG G-TTAACACC TTCATCGGAT CGATGAGCGC CTCCGCCGAA 
0301 GTGCTGGCCA TGGCCAAGAT CGAGATCAAG CTGTCCGACA TCCCGGAGGG CAAGTCGGTT 
0361 ACTTTCAAGT GGCGCGGAAA GCCCCTGTTC ATCCGCCACC GCACGGCCGC GGAAATCGAG 
0421 ACCGAGCGAA ATGTGCCCAC ATCCACGCTG CGCGATCCGG AGGCTGATGA TGT 
 Assemble Data

7361R-1.IR_full        1   AACGCCGTGTCGCGTGCTTACGTCAGAGGCGGAGCCNAGNGTCCTCTCCACGGGATTGA 59
                           |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
7361R-1.in silico      1   AACGCCGTGTCGCGTGCTTACGTCAGAGGCGGAGCCCAG-GTCCTCTCCACGGGATTGA 59


7361R-1.IR_full       61  AGGCGAGCGGCGTGGCCGTCAACTCGATGGCCAATCGCCAGGCACACACCGACCTGCAGG 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7361R-1.in silico     61  AGGCGAGCGGCGTGGCCGTCAACTCGATGGCCAATCGCCAGGCACACACCGACCTGCAGG 119


7361R-1.IR_full       121 TGCCAGACTTCTCGGCATACCGCCGGGAGTCCGTGAAGGACANTCGTCGTCGCAACGACA 179
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
7361R-1.in silico     121 TGCCAGACTTCTCGGCATACCGCCGGGAGTCCGTGAAGGACAGTCGTCGTCGCAACGACA 179


7361R-1.IR_full       181 CCGCCGAGGAGCGCAAGGCCTTCTCCTACTTGATGGTCGGCGCCGGANCCGTGGGCGGTG 239
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
7361R-1.in silico     181 CCGCCGAGGAGCGCAAGGCCTTCTCCTACTTGATGGTCGGCGCCGGAGCCGTGGGCGGTG 239


7361R-1.IR_full       241 CCTATGCNGCCAAGGGCCTGGNTTAACACCTTCATCGGATCGATGAGCGCCTCCGCCGAA 299
                          ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||
7361R-1.in silico     241 CCTATGCGGCCAAGGGCCTGG-TTAACACCTTCATCGGATCGATGAGCGCCTCCGCCGAA 299


7361R-1.IR_full       301 GTNCTGGNCATGGCCAAGATCGAGATCAAGCTGTCCGACATCCCGGAGGGCAAGTCGGTT 359
                          || |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
7361R-1.in silico     301 GTGCTGGCCATGGCCAAGATCGAGATCAAGCTGTCCGACATCCCGGAGGGCAAGTCGGTT 359


7361R-1.IR_full       361 ACTTTCAAGTGGCGCGGAAAGCCCCTGTTCATCCGCCACCGCACGGCCGCGGAAATCGAG 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7361R-1.in silico     361 ACTTTCAAGTGGCGCGGAAAGCCCCTGTTCATCCGCCACCGCACGGCCGCGGAAATCGAG 419


7361R-1.IR_full       421 ACCGAGCGAAATGTGCCCACATCCNCNCTNCGCGATCCGGAGGCTGATGATGT 472
                          |||||||||||||||||||||||| | || |||||||||||||||||||||||
7361R-1.in silico     421 ACCGAGCGAAATGTGCCCACATCCACGCTGCGCGATCCGGAGGCTGATGATGT 472

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   453  NM_080009.2  CG7361-RA, transcript variant A (RFeSP), mRNA 
99.55   451  NM_164426.1  CG7361-RB, transcript variant B (RFeSP), mRNA 
0.22   NM_136363.2  CG8343-RA (CG8343), mRNA 
0   NM_164869.1  CG18660-RA, transcript variant A (Nckx30C), mRNA 
0   NM_164870.1  CG18660-RB, transcript variant B (Nckx30C), mRNA 
0   NM_143754.2  CG18660-RC, transcript variant C (Nckx30C), mRNA 
0   NM_141346.2  CG2017-RA, transcript variant A (CG2017), mRNA 
0   NM_169117.1  CG2017-RD, transcript variant D (CG2017), mRNA 
0   NM_169116.1  CG2017-RC, transcript variant C (CG2017), mRNA 
0   NM_169115.1  CG2017-RB, transcript variant B (CG2017), mRNA 
0   NM_136154.1  CG10631-RA (CG10631), mRNA 
0   NM_170540.1  CG31004-RB, transcript variant B (CG31004), mRNA 
0   NM_170539.1  CG31004-RA, transcript variant A (CG31004), mRNA 
0   NM_078690.2  CG12530-RA, transcript variant A (Cdc42), mRNA 
0   NM_167677.1  CG12530-RB, transcript variant B (Cdc42), mRNA 
0   NM_167942.1  CG1275-RA, transcript variant A (CG1275), mRNA 
0   NM_139446.2  CG1275-RB, transcript variant B (CG1275), mRNA 
0   NM_206241.1  CG1275-RD, transcript variant D (CG1275), mRNA 
0   NM_167941.1  CG1275-RC, transcript variant C (CG1275), mRNA 
0   NM_137058.2  CG12295-RB (stj), mRNA 
0   NM_176438.1  CG8312-RB, transcript variant B (CG8312), mRNA 
0   NM_141661.1  CG8312-RA, transcript variant A (CG8312), mRNA 
0   NM_136987.2  CG13321-RA (CG13321), mRNA 
0   NM_206630.1  CG3312-RB, transcript variant B (Rnp4F), mRNA 
0   NM_078492.2  CG3312-RA, transcript variant A (Rnp4F), mRNA 
0   NM_131938.1  CG3568-RA (CG3568), mRNA 
0   NM_140744.1  CG6064-RA (TORC), mRNA 
0   NM_079814.2  CG5502-RA (RpL4), mRNA 
0   NM_143198.1  CG14542-RA (CG14542), mRNA 
0   NM_001014513.1  CG8739-RC, transcript variant C (cmp44E), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.