National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7340R-4 
 Symbol granny-smith  Full Name granny smith 
 CG No CG7340  Old CG No CG7340 
 Synonyms BcDNA:LD41548, CG7340, unnamed, l(3)c00064, granny-smith 
 Accession No (Link to NCBI) NM_141983.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCGC-TTCAAAAAGATGGCCACGGACGTAAAGTTTAACGAGTCGCTAGGCTGCAGTGATC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGCAGACACATCCGGTCCTGATCATCGGCCAGCTGCGCCATCTAAACCTACTGAAGTTCA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GTCATCTGGAGAGCAAACTCAGTCCGCGCGTCACCGAGGAGACCTTCCTGAATGCCGTCG 180

                          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| silico     181 CTTGTCTGCATCCCGCGCCCACCGATAAGGTATCCCTCTATCTCGATGTGGCCACCGTGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTGCCCTGCCATTGAAGGCATCCCGACACAATACGGCATCCCGGGCTCATGCCATCACTC 300

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     301 GTCTGGTAAAGAACCATGTGCTGAACGTTTCCGAGGAGAGCGTGGT-GCTCGTCTGCGAA 360

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     361 CGAGAGAATCTATTCGCCAGCGCCTGTGCGGTGGTTCGCGCTTTTCCACTCTATTCCCGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAAACGGGCAATCTGCTGGCCTCAAGTCAGCCAAAGCTAAATCTTGGATGTGGAGATGGA 480

7340R-4.IR_full       481 AACGCAAATTCAGGACGCAACG 502
                          |||||||||||||||||||||| silico     481 AACGCAAATTCAGGACGCAACG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141983.2  CG7340-RB, transcript variant B (granny-smith), mRNA 
97.3   469  NM_169483.1  CG7340-RC, transcript variant C (granny-smith), mRNA 
97.3   469  NM_169482.1  CG7340-RA, transcript variant A (granny-smith), mRNA 
0   NM_136458.2  CG30494-RA (CG30494), mRNA 
0   NM_141953.1  CG18554-RA (CG18554), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_175983.1  CG8222-RC, transcript variant C (Pvr), mRNA 
0   NM_205926.1  CG8222-RE, transcript variant E (Pvr), mRNA 
0   NM_205925.1  CG8222-RF, transcript variant F (Pvr), mRNA 
0   NM_078785.2  CG8222-RA, transcript variant A (Pvr), mRNA 
0   NM_164801.1  CG8222-RB, transcript variant B (Pvr), mRNA 
0   NM_205927.1  CG8222-RD, transcript variant D (Pvr), mRNA 
0   NM_169503.1  CG32473-RA, transcript variant A (CG32473), mRNA 
0   NM_167176.1  CG7033-RB, transcript variant B (CG7033), mRNA 
0   NM_132296.2  CG7033-RA, transcript variant A (CG7033), mRNA 
0   NM_176715.1  CG7033-RC, transcript variant C (CG7033), mRNA 
0   NM_142347.1  CG5255-RA (CG5255), mRNA 
0   NM_167865.1  CG32333-RA, transcript variant A (CG32333), mRNA 
0   NM_140276.2  CG6947-RA (CG6947), mRNA 
0   NM_168389.1  CG6707-RB, transcript variant B (CG6707), mRNA 
0   NM_168388.1  CG6707-RC, transcript variant C (CG6707), mRNA 
0   NM_140115.1  CG6707-RA, transcript variant A (CG6707), mRNA 
0   NM_167218.1  CG32685-RC (CG32685), mRNA 
0   NM_140826.2  CG3808-RA (CG3808), mRNA 
0   NM_206519.1  CG4433-RB, transcript variant B (CG4433), mRNA 
0   NM_142600.2  CG4433-RA, transcript variant A (CG4433), mRNA 
0   NM_058148.3  CG2637-RA (Fs(2)Ket), mRNA 
0   NM_142889.1  CG4374-RA (CG4374), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.