National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7340R-2 
 Symbol granny-smith  Full Name granny smith 
 CG No CG7340  Old CG No CG7340 
 Synonyms BcDNA:LD41548, CG7340, unnamed, l(3)c00064, granny-smith 
 Accession No (Link to NCBI) NM_141983.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGCTTCAAAAAGATGGCCAC 
 Primer Seq. 3'
aatctagaggtaccCGTTGCGTCCTGAATTTGCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCGCATTCAA AAAGATGGCC ACGGACGTAA AGTTTAACGA GTCGCTAGGC TGCAGTGATC 
0061 CGCAGACACA TCCGGTCCTG ATCATCGGCC AGCTGCGCCA TCTAAACCTA CTGAAGTTCA 
0121 GTCATCTGGA GAGCAAACTC AGTCCGCGCG TCACCGAGGA GACCTTCCTG AATGCCGTCG 
0181 CTTGTCTGCA TCCCGCGCCC GCCGATAAGG TATCCCTCTA TCTCGATGTG GCCACCGTGG 
0241 CTGCCCTGCC ATTGAAGGCA TCCCGACACA ATACGGCATC CCGGGCTCAT GCCATCACTC 
0301 GTCTGGTAAA GAACCATGTG CTGAACGTTT CCGAGGAGAG CGTGGTNGCT CGTCTGCGAA 
0361 CGAGAGAATC TATTCGCCAG CGCCTGTGCG GTGGTTCGCG CTTTTCCACT CTATTNCCGC 
0421 AAAACGGGCA ATCTGCTGGC CTCAAGTCAG CCAAAGCTAA ATCTTGGATG TGGAGATGGA 
0481 AACGCAAATT CAGGACGCAA CG 
 in silico PCR Fragment
0001 CCGC-TTCAA AAAGATGGCC ACGGACGTAA AGTTTAACGA GTCGCTAGGC TGCAGTGATC 
0061 CGCAGACACA TCCGGTCCTG ATCATCGGCC AGCTGCGCCA TCTAAACCTA CTGAAGTTCA 
0121 GTCATCTGGA GAGCAAACTC AGTCCGCGCG TCACCGAGGA GACCTTCCTG AATGCCGTCG 
0181 CTTGTCTGCA TCCCGCGCCC ACCGATAAGG TATCCCTCTA TCTCGATGTG GCCACCGTGG 
0241 CTGCCCTGCC ATTGAAGGCA TCCCGACACA ATACGGCATC CCGGGCTCAT GCCATCACTC 
0301 GTCTGGTAAA GAACCATGTG CTGAACGTTT CCGAGGAGAG CGTGGT-GCT CGTCTGCGAA 
0361 CGAGAGAATC TATTCGCCAG CGCCTGTGCG GTGGTTCGCG CTTTTCCACT CTATTCCCGC 
0421 AAAACGGGCA ATCTGCTGGC CTCAAGTCAG CCAAAGCTAA ATCTTGGATG TGGAGATGGA 
0481 AACGCAAATT CAGGACGCAA CG 
 Assemble Data

7340R-2.IR_full       1   CCGCATTCAAAAAGATGGCCACGGACGTAAAGTTTAACGAGTCGCTAGGCTGCAGTGATC 60
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340R-2.in silico     1   CCGC-TTCAAAAAGATGGCCACGGACGTAAAGTTTAACGAGTCGCTAGGCTGCAGTGATC 60


7340R-2.IR_full       61  CGCAGACACATCCGGTCCTGATCATCGGCCAGCTGCGCCATCTAAACCTACTGAAGTTCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340R-2.in silico     61  CGCAGACACATCCGGTCCTGATCATCGGCCAGCTGCGCCATCTAAACCTACTGAAGTTCA 120


7340R-2.IR_full       121 GTCATCTGGAGAGCAAACTCAGTCCGCGCGTCACCGAGGAGACCTTCCTGAATGCCGTCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340R-2.in silico     121 GTCATCTGGAGAGCAAACTCAGTCCGCGCGTCACCGAGGAGACCTTCCTGAATGCCGTCG 180


7340R-2.IR_full       181 CTTGTCTGCATCCCGCGCCCGCCGATAAGGTATCCCTCTATCTCGATGTGGCCACCGTGG 240
                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
7340R-2.in silico     181 CTTGTCTGCATCCCGCGCCCACCGATAAGGTATCCCTCTATCTCGATGTGGCCACCGTGG 240


7340R-2.IR_full       241 CTGCCCTGCCATTGAAGGCATCCCGACACAATACGGCATCCCGGGCTCATGCCATCACTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340R-2.in silico     241 CTGCCCTGCCATTGAAGGCATCCCGACACAATACGGCATCCCGGGCTCATGCCATCACTC 300


7340R-2.IR_full       301 GTCTGGTAAAGAACCATGTGCTGAACGTTTCCGAGGAGAGCGTGGTNGCTCGTCTGCGAA 360
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7340R-2.in silico     301 GTCTGGTAAAGAACCATGTGCTGAACGTTTCCGAGGAGAGCGTGGT-GCTCGTCTGCGAA 360


7340R-2.IR_full       361 CGAGAGAATCTATTCGCCAGCGCCTGTGCGGTGGTTCGCGCTTTTCCACTCTATTNCCGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
7340R-2.in silico     361 CGAGAGAATCTATTCGCCAGCGCCTGTGCGGTGGTTCGCGCTTTTCCACTCTATTCCCGC 420


7340R-2.IR_full       421 AAAACGGGCAATCTGCTGGCCTCAAGTCAGCCAAAGCTAAATCTTGGATGTGGAGATGGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340R-2.in silico     421 AAAACGGGCAATCTGCTGGCCTCAAGTCAGCCAAAGCTAAATCTTGGATGTGGAGATGGA 480


7340R-2.IR_full       481 AACGCAAATTCAGGACGCAACG 502
                          ||||||||||||||||||||||
7340R-2.in silico     481 AACGCAAATTCAGGACGCAACG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141983.2  CG7340-RB, transcript variant B (granny-smith), mRNA 
97.3   469  NM_169483.1  CG7340-RC, transcript variant C (granny-smith), mRNA 
97.3   469  NM_169482.1  CG7340-RA, transcript variant A (granny-smith), mRNA 
0   NM_136458.2  CG30494-RA (CG30494), mRNA 
0   NM_141953.1  CG18554-RA (CG18554), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_175983.1  CG8222-RC, transcript variant C (Pvr), mRNA 
0   NM_205926.1  CG8222-RE, transcript variant E (Pvr), mRNA 
0   NM_205925.1  CG8222-RF, transcript variant F (Pvr), mRNA 
0   NM_078785.2  CG8222-RA, transcript variant A (Pvr), mRNA 
0   NM_164801.1  CG8222-RB, transcript variant B (Pvr), mRNA 
0   NM_205927.1  CG8222-RD, transcript variant D (Pvr), mRNA 
0   NM_169503.1  CG32473-RA, transcript variant A (CG32473), mRNA 
0   NM_167176.1  CG7033-RB, transcript variant B (CG7033), mRNA 
0   NM_132296.2  CG7033-RA, transcript variant A (CG7033), mRNA 
0   NM_176715.1  CG7033-RC, transcript variant C (CG7033), mRNA 
0   NM_142347.1  CG5255-RA (CG5255), mRNA 
0   NM_167865.1  CG32333-RA, transcript variant A (CG32333), mRNA 
0   NM_140276.2  CG6947-RA (CG6947), mRNA 
0   NM_168389.1  CG6707-RB, transcript variant B (CG6707), mRNA 
0   NM_168388.1  CG6707-RC, transcript variant C (CG6707), mRNA 
0   NM_140115.1  CG6707-RA, transcript variant A (CG6707), mRNA 
0   NM_167218.1  CG32685-RC (CG32685), mRNA 
0   NM_140826.2  CG3808-RA (CG3808), mRNA 
0   NM_206519.1  CG4433-RB, transcript variant B (CG4433), mRNA 
0   NM_142600.2  CG4433-RA, transcript variant A (CG4433), mRNA 
0   NM_058148.3  CG2637-RA (Fs(2)Ket), mRNA 
0   NM_142889.1  CG4374-RA (CG4374), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.