National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7340-1R-4 
 Symbol granny-smith  Full Name granny smith 
 CG No CG7340  Old CG No CG7340 
 Synonyms BcDNA:LD41548, CG7340, unnamed, l(3)c00064, granny-smith 
 Accession No (Link to NCBI) NM_141983.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCGTTTGCTGCTCTGCGTC 
 Primer Seq. 3'
aatctagaggtaccGCCAGCAGATTGCCCGTTTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCGTTTGC TGCTCTGCGT CCAGGCAATA CGCAACCATC TCGCTCGCAC CTACAGCAGC 
0061 GCCCGCTTCA AAAAGATGGC CACGGACGTA AAGTTTAACG AGTCGCTAGG CTGCAGTGAT 
0121 CCGCAGACAC ATCCGGTCCT GATCATCGGC CAGCTGCGCC ATCTAAACCT ACTGAAGTTC 
0181 AGTCATCTGG AGAGCAAACT CAGTCCGCGC GTCACCGAGG AGACCTTCCT GAATGCCGTC 
0241 GCTTGTCTGC ATCCCGCGCC CACCGATAAG GTATCCCTCT ATCTCGATGT GGCCACCGTG 
0301 GCTGCCCTGC CATTGAAGGC ATCCCGACAC AATACGGCAT CCCGGGCTCA TGCCATCACT 
0361 CGTCTGGTAA AGAACCATGT GCTGAACGTT TCCGAGGAGA GCGTGGTGCT CGTCTGCGAA 
0421 CGAGAGAATC TATTCGCCAG CGCCTGTGCG GTGGTTCGCG CTTTTCCACT CTATTCCCGC 
0481 AAAACGGGCA ATCTGCTGGC  
 in silico PCR Fragment
0001 ATGCGTTTGC TGCTCTGCGT CCAGGCAATA CGCAACCATC TCGCTCGCAC CTACAGCAGC 
0061 GCCCGCTTCA AAAAGATGGC CACGGACGTA AAGTTTAACG AGTCGCTAGG CTGCAGTGAT 
0121 CCGCAGACAC ATCCGGTCCT GATCATCGGC CAGCTGCGCC ATCTAAACCT ACTGAAGTTC 
0181 AGTCATCTGG AGAGCAAACT CAGTCCGCGC GTCACCGAGG AGACCTTCCT GAATGCCGTC 
0241 GCTTGTCTGC ATCCCGCGCC CACCGATAAG GTATCCCTCT ATCTCGATGT GGCCACCGTG 
0301 GCTGCCCTGC CATTGAAGGC ATCCCGACAC AATACGGCAT CCCGGGCTCA TGCCATCACT 
0361 CGTCTGGTAA AGAACCATGT GCTGAACGTT TCCGAGGAGA GCGTGGTGCT CGTCTGCGAA 
0421 CGAGAGAATC TATTCGCCAG CGCCTGTGCG GTGGTTCGCG CTTTTCCACT CTATTCCCGC 
0481 AAAACGGGCA ATCTGCTGGC  
 Assemble Data

7340-1R-4.IR_full       1   ATGCGTTTGCTGCTCTGCGTCCAGGCAATACGCAACCATCTCGCTCGCACCTACAGCAGC 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340-1R-4.in silico     1   ATGCGTTTGCTGCTCTGCGTCCAGGCAATACGCAACCATCTCGCTCGCACCTACAGCAGC 60


7340-1R-4.IR_full       61  GCCCGCTTCAAAAAGATGGCCACGGACGTAAAGTTTAACGAGTCGCTAGGCTGCAGTGAT 120
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340-1R-4.in silico     61  GCCCGCTTCAAAAAGATGGCCACGGACGTAAAGTTTAACGAGTCGCTAGGCTGCAGTGAT 120


7340-1R-4.IR_full       121 CCGCAGACACATCCGGTCCTGATCATCGGCCAGCTGCGCCATCTAAACCTACTGAAGTTC 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340-1R-4.in silico     121 CCGCAGACACATCCGGTCCTGATCATCGGCCAGCTGCGCCATCTAAACCTACTGAAGTTC 180


7340-1R-4.IR_full       181 AGTCATCTGGAGAGCAAACTCAGTCCGCGCGTCACCGAGGAGACCTTCCTGAATGCCGTC 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340-1R-4.in silico     181 AGTCATCTGGAGAGCAAACTCAGTCCGCGCGTCACCGAGGAGACCTTCCTGAATGCCGTC 240


7340-1R-4.IR_full       241 GCTTGTCTGCATCCCGCGCCCACCGATAAGGTATCCCTCTATCTCGATGTGGCCACCGTG 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340-1R-4.in silico     241 GCTTGTCTGCATCCCGCGCCCACCGATAAGGTATCCCTCTATCTCGATGTGGCCACCGTG 300


7340-1R-4.IR_full       301 GCTGCCCTGCCATTGAAGGCATCCCGACACAATACGGCATCCCGGGCTCATGCCATCACT 360
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340-1R-4.in silico     301 GCTGCCCTGCCATTGAAGGCATCCCGACACAATACGGCATCCCGGGCTCATGCCATCACT 360


7340-1R-4.IR_full       361 CGTCTGGTAAAGAACCATGTGCTGAACGTTTCCGAGGAGAGCGTGGTGCTCGTCTGCGAA 420
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340-1R-4.in silico     361 CGTCTGGTAAAGAACCATGTGCTGAACGTTTCCGAGGAGAGCGTGGTGCTCGTCTGCGAA 420


7340-1R-4.IR_full       421 CGAGAGAATCTATTCGCCAGCGCCTGTGCGGTGGTTCGCGCTTTTCCACTCTATTCCCGC 480
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7340-1R-4.in silico     421 CGAGAGAATCTATTCGCCAGCGCCTGTGCGGTGGTTCGCGCTTTTCCACTCTATTCCCGC 480


7340-1R-4.IR_full       481 AAAACGGGCAATCTGCTGGC 500
                            ||||||||||||||||||||
7340-1R-4.in silico     481 AAAACGGGCAATCTGCTGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141983.2  CG7340-RB, transcript variant B (granny-smith), mRNA 
84.43   407  NM_169482.1  CG7340-RA, transcript variant A (granny-smith), mRNA 
84.43   407  NM_169483.1  CG7340-RC, transcript variant C (granny-smith), mRNA 
0   NM_078659.3  CG5055-RA, transcript variant A (baz), mRNA 
0   NM_141953.1  CG18554-RA (CG18554), mRNA 
0   NM_136458.2  CG30494-RA (CG30494), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_205927.1  CG8222-RD, transcript variant D (Pvr), mRNA 
0   NM_164801.1  CG8222-RB, transcript variant B (Pvr), mRNA 
0   NM_078785.2  CG8222-RA, transcript variant A (Pvr), mRNA 
0   NM_205925.1  CG8222-RF, transcript variant F (Pvr), mRNA 
0   NM_205926.1  CG8222-RE, transcript variant E (Pvr), mRNA 
0   NM_175983.1  CG8222-RC, transcript variant C (Pvr), mRNA 
0   NM_169503.1  CG32473-RA, transcript variant A (CG32473), mRNA 
0   NM_176715.1  CG7033-RC, transcript variant C (CG7033), mRNA 
0   NM_132296.2  CG7033-RA, transcript variant A (CG7033), mRNA 
0   NM_167176.1  CG7033-RB, transcript variant B (CG7033), mRNA 
0   NM_142347.1  CG5255-RA (CG5255), mRNA 
0   NM_165773.2  CG2204-RC, transcript variant C (G-oalpha47A), mRNA 
0   NM_078960.4  CG2204-RA, transcript variant A (G-oalpha47A), mRNA 
0   NM_206079.1  CG2204-RI, transcript variant I (G-oalpha47A), mRNA 
0   NM_167865.1  CG32333-RA, transcript variant A (CG32333), mRNA 
0   NM_140276.2  CG6947-RA (CG6947), mRNA 
0   NM_168389.1  CG6707-RB, transcript variant B (CG6707), mRNA 
0   NM_168388.1  CG6707-RC, transcript variant C (CG6707), mRNA 
0   NM_140115.1  CG6707-RA, transcript variant A (CG6707), mRNA 
0   NM_140826.2  CG3808-RA (CG3808), mRNA 
0   NM_079648.2  CG5083-RA (Rbf2), mRNA 
0   NM_140448.1  CG9587-RA (CG9587), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.