National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7306R-4 
 Symbol obst-F  Full Name obstructor-F 
 CG No CG7306  Old CG No CG7306 
 Synonyms obst-F, CG7306 
 Accession No (Link to NCBI) NM_140929.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGGCATATGTCCTGGCATTGAGCATCTGCTTCCAGTTGGGAGCCGGTCACGCTGTGGAC 60

                          ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     61  CAAAGTTGGGAACTGCCCAAAGTTCGACATACTGTGGGTCACCTCAGCCATATCTGCTTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGACGTCAAGAGGGCGATTTGGTGCCACATCCGTTGGATTGTAATGGATATTTCTCCTGC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCGCGTGTGCCCACTCTACTCTACTGCGACCAGGGCCTTCAGTTCGACGAGAACCGTGCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATATGCGATCTGCCGGAGAATACCAACTGTCGTCCCGTAGCCACTGGCACTGTGGAATCC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     301 GCAAATGGCCTGGCGGATAACTCCGAGCTCAACTGGTGGCCACACAAGCCGAAGCCCGTC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTTGTGGCCGTCGATGTGACCAGTGGTCAGCCGGTTAATCCCATGGAGAAGTACGATCCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGCATATCGAGTGCCGTCACTATGGAGCCTACTTCCTGCCGCACCCCAGAAATTGTGGA 480

7306R-4.IR_full       481 CTGTACTTCATCTGCGCCTA 500
                          |||||||||||||||||||| silico     481 CTGTACTTCATCTGCGCCTA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140929.1  CG7306-RA (CG7306), mRNA 
0.2   NM_136362.2  CG8345-RA (Cyp6w1), mRNA 
0   NM_206497.1  CG10388-RF, transcript variant F (Ubx), mRNA 
0   NM_169730.1  CG10388-RC, transcript variant C (Ubx), mRNA 
0   NM_080504.2  CG10388-RA, transcript variant A (Ubx), mRNA 
0   NM_080500.2  CG10388-RB, transcript variant B (Ubx), mRNA 
0   NM_169728.1  CG10388-RD, transcript variant D (Ubx), mRNA 
0   NM_169729.1  CG10388-RE, transcript variant E (Ubx), mRNA 
0   12  NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_136458.2  CG30494-RA (CG30494), mRNA 
0   NM_164577.1  CG15427-RC, transcript variant C (tutl), mRNA 
0   NM_164578.1  CG15427-RA, transcript variant A (tutl), mRNA 
0   NM_080127.4  CG15427-RE, transcript variant E (tutl), mRNA 
0   NM_164576.2  CG15427-RD, transcript variant D (tutl), mRNA 
0   NM_079198.2  CG15010-RC, transcript variant C (ago), mRNA 
0   NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 
0   NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_001038850.1  CG9027-RC, transcript variant C (CG9027), mRNA 
0   NM_134529.2  CG9575-RA (Rab35), mRNA 
0   NM_168756.1  CG8127-RC, transcript variant C (Eip75B), mRNA 
0   NM_078596.2  CG1372-RA, transcript variant A (yl), mRNA 
0   NM_206710.1  CG1372-RB, transcript variant B (yl), mRNA 
0   NM_132498.1  CG1572-RA, transcript variant A (CG1572), mRNA 
0   NM_167289.1  CG1572-RB, transcript variant B (CG1572), mRNA 
0   NM_166772.1  CG1862-RD, transcript variant D (Ephrin), mRNA 
0   NM_166771.1  CG1862-RC, transcript variant C (Ephrin), mRNA 
0   NM_143670.4  CG1862-RB, transcript variant B (Ephrin), mRNA 
0   NM_166770.1  CG1862-RA, transcript variant A (Ephrin), mRNA 
0   NM_079770.2  CG7748-RA (OstStt3), mRNA 
0   NM_168053.1  CG32254-RA (CG32254), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.