National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7242R-3 
 Symbol CG7242  Full Name CG7242 
 CG No CG7242  Old CG No CG7242 
 Synonyms BcDNA:LD37196, unnamed, l(3)c00064, CG7242 
 Accession No (Link to NCBI) NM_141982.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATCGAGTTACGAAAGGCGCGTAAAGGCTTTGTACGAAAAACAAATTCACATGGAAGCCCT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGAGGCGAAATTCATCAAAAAGGTCTTTAAATTCAACAGCAATTTGTTGGATGTCAAGGA 120

                          ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGCAG-CTTCGCGCCATCAGCGGAAAGTGGGAAAGTTGCAAAAAGTGCTCATGGAGCGGC 180

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| silico     181 GGGAGGAGTTGGACAAGCGAGTTTCCTTCATAGAGGAACTTGATCGAGAACTGGAGGCCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCAAACTTCACAATTTGGCCATGAAAGATTGGTTTAAACAGCAGAAAATGCTGGCCAAAC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCGCAAAAACGAAATCATGGAAAGCATTCACACGCTGTCGAAGACAACAAGAACCTATA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TAAATCAAGAAGCGCTGCCGGCACGTGTGAAGGGTGTCACTGTACTCCGTGGCGATAAAC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCGACCAGTTGATACCCTTTGATCTGAAGGCGACCGATGTGGAAGGACTGGACTCACTGT 480

7242R-3.IR_full       481 GTCAGCATCTCGAGAGTCTAA 501
                          ||||||||||||||||||||| silico     481 GTCAGCATCTCGAGAGTCTAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141982.2  CG7242-RA (CG7242), mRNA 
0   NM_206469.1  CG11870-RD, transcript variant D (CG11870), mRNA 
0   NM_141734.2  CG11870-RA, transcript variant A (CG11870), mRNA 
0   NM_169337.2  CG11870-RB, transcript variant B (CG11870), mRNA 
0   NM_206470.1  CG11870-RC, transcript variant C (CG11870), mRNA 
0   NM_140246.1  CG6024-RA, transcript variant A (CG6024), mRNA 
0   NM_206341.1  CG6024-RB, transcript variant B (CG6024), mRNA 
0   NM_058010.3  CG8200-RA, transcript variant A (Flo), mRNA 
0   NM_166102.1  CG8200-RB, transcript variant B (Flo), mRNA 
0   NM_001043280.1  CG34149-RA (CG34149), mRNA 
0   NM_165800.1  CG12342-RB, transcript variant B (CG12342), mRNA 
0   NM_168453.1  CG18490-RC, transcript variant C (CG18490), mRNA 
0   NM_136770.1  CG12342-RA, transcript variant A (CG12342), mRNA 
0   NM_140197.1  CG18490-RB, transcript variant B (CG18490), mRNA 
0   NM_132926.1  CG13008-RA, transcript variant A (CG13008), mRNA 
0   NM_136202.4  CG31678-RA (CG31678), mRNA 
0   NM_140488.2  CG6945-RA (CG6945), mRNA 
0   NM_138008.3  CG13565-RA (CG13565), mRNA 
0   NM_001015210.1  CG40343-PA.3 (CG40343), mRNA 
0   NM_137927.1  CG9871-RA (CG9871), mRNA 
0   14  NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_206144.1  CG15609-RB, transcript variant B (CG15609), mRNA 
0   NM_137335.2  CG15609-RA, transcript variant A (CG15609), mRNA 
0   NM_206143.1  CG15609-RC, transcript variant C (CG15609), mRNA 
0   NM_057516.3  CG5403-RA, transcript variant A (retn), mRNA 
0   NM_176254.1  CG5403-RB, transcript variant B (retn), mRNA 
0   10  NM_137727.1  CG10505-RA (CG10505), mRNA 
0   10  NM_142215.2  CG5205-RA (CG5205), mRNA 
0   NM_143593.2  CG1542-RA (CG1542), mRNA 
0   NM_142894.1  CG10175-RC, transcript variant C (CG10175), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.