National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7242R-2 
 Symbol CG7242  Full Name CG7242 
 CG No CG7242  Old CG No CG7242 
 Synonyms BcDNA:LD37196, unnamed, l(3)c00064, CG7242 
 Accession No (Link to NCBI) NM_141982.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCGAGTTACGAAAGGCGCGT 
 Primer Seq. 3'
aatctagaggtaccTTAGACTCTCGAGATGCTGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCGAGTTAC GAAAGGCGCG TAAAGGCTTT GTACGAAAAA CAAATTCACA TGGAAGCCCT 
0061 CGAGGCGAAA TTCATCAAAA AGGTCTTTAA ATTCAACAGC AATTTGTTGG ATGTCAAGGA 
0121 AGCAGCCTTC GCGCCATCAG CGGAAAGTGG GAAAGTTGCA AAAAGTGCTC ATGGAGCGGC 
0181 GGGAGGAGTT GGAAAAGCGA GTTTCCTTCA TAGAGGAACT TGATCGAGAA CTAGAGGCCA 
0241 CCAAACTTCA CAATTTGGCC ATGAAAGATT GGTTTAAACA GCAGAAAATG CTGGCCAAAC 
0301 AGCGCAAAAA CGAAATCATG GAAAGCATTC ACACGCTGTC GAAGACAACA AGAACCTATA 
0361 TAAATCAAGA AGCGCTGCCG GCACGTGTGA AGGGTGTCAC TGTACTCCGT GGCGATAAAC 
0421 GCGACCAGTT GATACCCTTT GATCTGAAGG CGACCGATGT GGAAGGACTG GACTCACTGT 
0481 GTCAGCATCT CGAGAGTCTA A 
 in silico PCR Fragment
0001 ATCGAGTTAC GAAAGGCGCG TAAAGGCTTT GTACGAAAAA CAAATTCACA TGGAAGCCCT 
0061 CGAGGCGAAA TTCATCAAAA AGGTCTTTAA ATTCAACAGC AATTTGTTGG ATGTCAAGGA 
0121 AGCAG-CTTC GCGCCATCAG CGGAAAGTGG GAAAGTTGCA AAAAGTGCTC ATGGAGCGGC 
0181 GGGAGGAGTT GGACAAGCGA GTTTCCTTCA TAGAGGAACT TGATCGAGAA CTGGAGGCCA 
0241 CCAAACTTCA CAATTTGGCC ATGAAAGATT GGTTTAAACA GCAGAAAATG CTGGCCAAAC 
0301 AGCGCAAAAA CGAAATCATG GAAAGCATTC ACACGCTGTC GAAGACAACA AGAACCTATA 
0361 TAAATCAAGA AGCGCTGCCG GCACGTGTGA AGGGTGTCAC TGTACTCCGT GGCGATAAAC 
0421 GCGACCAGTT GATACCCTTT GATCTGAAGG CGACCGATGT GGAAGGACTG GACTCACTGT 
0481 GTCAGCATCT CGAGAGTCTA A 
 Assemble Data

7242R-2.IR_full       1   ATCGAGTTACGAAAGGCGCGTAAAGGCTTTGTACGAAAAACAAATTCACATGGAAGCCCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7242R-2.in silico     1   ATCGAGTTACGAAAGGCGCGTAAAGGCTTTGTACGAAAAACAAATTCACATGGAAGCCCT 60


7242R-2.IR_full       61  CGAGGCGAAATTCATCAAAAAGGTCTTTAAATTCAACAGCAATTTGTTGGATGTCAAGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7242R-2.in silico     61  CGAGGCGAAATTCATCAAAAAGGTCTTTAAATTCAACAGCAATTTGTTGGATGTCAAGGA 120


7242R-2.IR_full       121 AGCAGCCTTCGCGCCATCAGCGGAAAGTGGGAAAGTTGCAAAAAGTGCTCATGGAGCGGC 180
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
7242R-2.in silico     121 AGCAG-CTTCGCGCCATCAGCGGAAAGTGGGAAAGTTGCAAAAAGTGCTCATGGAGCGGC 180


7242R-2.IR_full       181 GGGAGGAGTTGGAAAAGCGAGTTTCCTTCATAGAGGAACTTGATCGAGAACTAGAGGCCA 240
                          ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||
7242R-2.in silico     181 GGGAGGAGTTGGACAAGCGAGTTTCCTTCATAGAGGAACTTGATCGAGAACTGGAGGCCA 240


7242R-2.IR_full       241 CCAAACTTCACAATTTGGCCATGAAAGATTGGTTTAAACAGCAGAAAATGCTGGCCAAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7242R-2.in silico     241 CCAAACTTCACAATTTGGCCATGAAAGATTGGTTTAAACAGCAGAAAATGCTGGCCAAAC 300


7242R-2.IR_full       301 AGCGCAAAAACGAAATCATGGAAAGCATTCACACGCTGTCGAAGACAACAAGAACCTATA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7242R-2.in silico     301 AGCGCAAAAACGAAATCATGGAAAGCATTCACACGCTGTCGAAGACAACAAGAACCTATA 360


7242R-2.IR_full       361 TAAATCAAGAAGCGCTGCCGGCACGTGTGAAGGGTGTCACTGTACTCCGTGGCGATAAAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7242R-2.in silico     361 TAAATCAAGAAGCGCTGCCGGCACGTGTGAAGGGTGTCACTGTACTCCGTGGCGATAAAC 420


7242R-2.IR_full       421 GCGACCAGTTGATACCCTTTGATCTGAAGGCGACCGATGTGGAAGGACTGGACTCACTGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7242R-2.in silico     421 GCGACCAGTTGATACCCTTTGATCTGAAGGCGACCGATGTGGAAGGACTGGACTCACTGT 480


7242R-2.IR_full       481 GTCAGCATCTCGAGAGTCTAA 501
                          |||||||||||||||||||||
7242R-2.in silico     481 GTCAGCATCTCGAGAGTCTAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141982.2  CG7242-RA (CG7242), mRNA 
0   NM_206469.1  CG11870-RD, transcript variant D (CG11870), mRNA 
0   NM_141734.2  CG11870-RA, transcript variant A (CG11870), mRNA 
0   NM_169337.2  CG11870-RB, transcript variant B (CG11870), mRNA 
0   NM_206470.1  CG11870-RC, transcript variant C (CG11870), mRNA 
0   NM_140246.1  CG6024-RA, transcript variant A (CG6024), mRNA 
0   NM_206341.1  CG6024-RB, transcript variant B (CG6024), mRNA 
0   NM_058010.3  CG8200-RA, transcript variant A (Flo), mRNA 
0   NM_166102.1  CG8200-RB, transcript variant B (Flo), mRNA 
0   NM_001043280.1  CG34149-RA (CG34149), mRNA 
0   NM_165800.1  CG12342-RB, transcript variant B (CG12342), mRNA 
0   NM_168453.1  CG18490-RC, transcript variant C (CG18490), mRNA 
0   NM_136770.1  CG12342-RA, transcript variant A (CG12342), mRNA 
0   NM_140197.1  CG18490-RB, transcript variant B (CG18490), mRNA 
0   NM_132926.1  CG13008-RA, transcript variant A (CG13008), mRNA 
0   NM_136202.4  CG31678-RA (CG31678), mRNA 
0   NM_140488.2  CG6945-RA (CG6945), mRNA 
0   NM_138008.3  CG13565-RA (CG13565), mRNA 
0   NM_001015210.1  CG40343-PA.3 (CG40343), mRNA 
0   NM_137927.1  CG9871-RA (CG9871), mRNA 
0   14  NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_206144.1  CG15609-RB, transcript variant B (CG15609), mRNA 
0   NM_137335.2  CG15609-RA, transcript variant A (CG15609), mRNA 
0   NM_206143.1  CG15609-RC, transcript variant C (CG15609), mRNA 
0   NM_057516.3  CG5403-RA, transcript variant A (retn), mRNA 
0   NM_176254.1  CG5403-RB, transcript variant B (retn), mRNA 
0   10  NM_137727.1  CG10505-RA (CG10505), mRNA 
0   10  NM_142215.2  CG5205-RA (CG5205), mRNA 
0   NM_143593.2  CG1542-RA (CG1542), mRNA 
0   NM_142894.1  CG10175-RC, transcript variant C (CG10175), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.