National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7241R-4 
 Symbol Cyp304a1  Full Name Cyp304a1 
 CG No CG7241  Old CG No CG7241 
 Synonyms CYP304A1-Dm, 304a1, CG7241, BcDNA:LP06355, Cyp304a1 
 Accession No (Link to NCBI) NM_169484.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAACTCTCCTGACGATCTGCG 
 Primer Seq. 3'
aatctagaggtaccCGGATACTTTGGACCGTTGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAACTCTCCT GACGATCTGC GCGGCGGTGT TCCTCTGCCT TTCGTATCGA TATGCAGTGG 
0061 GTCGACCCTC CGGCTTTCCA CCCGGTCCTC CAAAGATTCC GCTTTTCGGC AGCTACCTCT 
0121 TCATGCTGAT CATCAACTTT AAGTATCTGC ACAAGGCGGC TCTGACCCTC AGTCGGTGGT 
0181 ACAAGTCGGA TATCATTGGA CTGCATGTGG GTCCTTTTNC CGGTGGCCGT TGTCCACAGT 
0241 GCGGATGGAG TGCGCGAGAT CCTCAATAAT CAGGTGTTTG ATGGACGGCC GCAGCTTTTC 
0301 GTGGCCGCCA TGCGCGATCC CGGCCAAGAT GTGCGAGGGA TCTTTTTCCA GGATGGCCCC 
0361 CTGTGGAAGG AGCAACGTCG CTTCATCCTG CGCTACTTAA GAGACTTTGG CTTCGGACGA 
0421 CGATTCGACC AACTGGAGCT GGTCATCCAG GAGCAGTTGA ACGACATGCT GGATCTGATC 
0481 CGCAACGGTC CAAAGTATCC G 
 in silico PCR Fragment
0001 AAACTCTCCT GACGATCTGC GCGGCGGTGT TCCTCTGCCT TTCGTATCGA TATGCAGTGG 
0061 GTCGACCCTC CGGCTTTCCA CCCGGTCCTC CAAAGATTCC GCTTTTCGGC AGCTACCTCT 
0121 TCATGTTGAT CATCAACTTT AAGTATCTGC ACAAGGCGGC TCTGACCCTC AGTCGGTGGT 
0181 ACAAGTCGGA TATCATTGGA CTGCATGTGG GTCCTTTT-C CGGTGGCCGT TGTCCACAGT 
0241 GCGGATGGAG TGCGCGAGAT CCTCAATAAT CAGGTGTTCG ATGGACGGCC GCAGCTTTTC 
0301 GTGGCCGCCA TGCGCGATCC CGGCCAAGAT GTGCGAGGGA TCTTTTTCCA GGATGGCCCC 
0361 CTGTGGAAGG AGCAACGTCG CTTCATCCTG CGCTACTTAA GAGACTTTGG TTTCGGACGA 
0421 CGATTCGACC AACTGGAGCT GGTCATCCAG GAGCAGTTGA ACGACATGCT GGATCTGATC 
0481 CGCAACGGTC CAAAGTATCC G 
 Assemble Data

7241R-4.IR_full       1   AAACTCTCCTGACGATCTGCGCGGCGGTGTTCCTCTGCCTTTCGTATCGATATGCAGTGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7241R-4.in silico     1   AAACTCTCCTGACGATCTGCGCGGCGGTGTTCCTCTGCCTTTCGTATCGATATGCAGTGG 60


7241R-4.IR_full       61  GTCGACCCTCCGGCTTTCCACCCGGTCCTCCAAAGATTCCGCTTTTCGGCAGCTACCTCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7241R-4.in silico     61  GTCGACCCTCCGGCTTTCCACCCGGTCCTCCAAAGATTCCGCTTTTCGGCAGCTACCTCT 120


7241R-4.IR_full       121 TCATGCTGATCATCAACTTTAAGTATCTGCACAAGGCGGCTCTGACCCTCAGTCGGTGGT 180
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
7241R-4.in silico     121 TCATGTTGATCATCAACTTTAAGTATCTGCACAAGGCGGCTCTGACCCTCAGTCGGTGGT 180


7241R-4.IR_full       181 ACAAGTCGGATATCATTGGACTGCATGTGGGTCCTTTTNCCGGTGGCCGTTGTCCACAGT 240
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
7241R-4.in silico     181 ACAAGTCGGATATCATTGGACTGCATGTGGGTCCTTTT-CCGGTGGCCGTTGTCCACAGT 240


7241R-4.IR_full       241 GCGGATGGAGTGCGCGAGATCCTCAATAATCAGGTGTTTGATGGACGGCCGCAGCTTTTC 300
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
7241R-4.in silico     241 GCGGATGGAGTGCGCGAGATCCTCAATAATCAGGTGTTCGATGGACGGCCGCAGCTTTTC 300


7241R-4.IR_full       301 GTGGCCGCCATGCGCGATCCCGGCCAAGATGTGCGAGGGATCTTTTTCCAGGATGGCCCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7241R-4.in silico     301 GTGGCCGCCATGCGCGATCCCGGCCAAGATGTGCGAGGGATCTTTTTCCAGGATGGCCCC 360


7241R-4.IR_full       361 CTGTGGAAGGAGCAACGTCGCTTCATCCTGCGCTACTTAAGAGACTTTGGCTTCGGACGA 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
7241R-4.in silico     361 CTGTGGAAGGAGCAACGTCGCTTCATCCTGCGCTACTTAAGAGACTTTGGTTTCGGACGA 420


7241R-4.IR_full       421 CGATTCGACCAACTGGAGCTGGTCATCCAGGAGCAGTTGAACGACATGCTGGATCTGATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7241R-4.in silico     421 CGATTCGACCAACTGGAGCTGGTCATCCAGGAGCAGTTGAACGACATGCTGGATCTGATC 480


7241R-4.IR_full       481 CGCAACGGTCCAAAGTATCCG 501
                          |||||||||||||||||||||
7241R-4.in silico     481 CGCAACGGTCCAAAGTATCCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169484.1  CG7241-RA (Cyp304a1), mRNA 
0   NM_136053.2  CG10338-RA (CG10338), mRNA 
0   NM_206717.2  CG9220-RC (CG9220), mRNA 
0   NM_079503.2  CG9761-RA (Nep2), mRNA 
0   NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_141004.1  CG3680-RA (CG3680), mRNA 
0   NM_001014591.1  CG8103-RB, transcript variant B (Mi-2), mRNA 
0   NM_140897.2  CG8103-RA, transcript variant A (Mi-2), mRNA 
0   NM_175991.1  CG10595-RA, transcript variant A (d), mRNA 
0   NM_205940.1  CG10595-RB, transcript variant B (d), mRNA 
0   NM_205939.1  CG10595-RC, transcript variant C (d), mRNA 
0   NM_142046.1  CG9591-RA (omd), mRNA 
0   NM_134536.2  CG17065-RA (CG17065), mRNA 
0   NM_139410.1  CG13935-RA (CG13935), mRNA 
0   NM_164670.1  CG9075-RD, transcript variant D (eIF-4a), mRNA 
0   NM_164669.1  CG9075-RB, transcript variant B (eIF-4a), mRNA 
0   NM_057247.3  CG9075-RC, transcript variant C (eIF-4a), mRNA 
0   NM_164668.1  CG9075-RA, transcript variant A (eIF-4a), mRNA 
0   11  NM_078863.4  CG17927-RH, transcript variant H (Mhc), mRNA 
0   11  NM_165188.1  CG17927-RI, transcript variant I (Mhc), mRNA 
0   11  NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   11  NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   11  NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   11  NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   11  NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   11  NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   11  NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_206729.1  CG9012-RC, transcript variant C (Chc), mRNA 
0   NM_206728.1  CG9012-RD, transcript variant D (Chc), mRNA 
0   NM_057694.2  CG9012-RA, transcript variant A (Chc), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.