National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7235R-2 
 Symbol Hsp60C  Full Name Hsp60C 
 CG No CG7235  Old CG No CG7235 
 Synonyms CG7235, bs36d10.y1, Hsp60C 
 Accession No (Link to NCBI) NM_164654.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Owusu-Ansah E, Song W, Perrimon N.
Muscle mitohormesis promotes longevity via systemic repression of insulin signaling.
Cell (2013) 155(3) 699-712 [ PubMed ID = 24243023 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCACGTCCTGTGGGCCCGTAA 
 Primer Seq. 3'
aatctagaggtaccGGTTTCCCACCGACTTGTCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCACGTCCTG TGGGCCCGTA ACTATGCAAA GGATGTTAGG TTCGGGCCGA GAGGTGAGGG 
0061 CCATGATGCT GCAGGGAGTG GACGTGCTGG CGGATNNCGT GNGCCGTGAC CATGGGACCA 
0121 AAGGGACGCA ACGTGATCAT CGAGCAGAGC TGGGGATCGC CAAAGATTAC CAAGGACGGC 
0181 GTGACGGTGG CCAAGTCGAT TGCCCTCAAG GACAAGTTCC AGAATATCGG CGCCAAACTG 
0241 GTGCAGGNAT GTGGCGAACA ACACGAACGA GGAGGCAGGT GATGGCACCA CCACGGCCAC 
0301 CGTTCTGGCC CGCGCCATTG CCAAGGAGNG GATTCGAGAA GATTTCACGG GGTGCCAGTC 
0361 CGGTGGAGAT CCGCCGCGGA GTTATGCTAG CCATCGAGAC GGTCAAGGAC AACCTTCGTC 
0421 GGTTGTCCCG GCCAGTTAAC ACGCCCGAGG AGATCTGCCA GGTGGCGACG ATCTCTGCGA 
0481 ACGGCGACAA GTCGGTGGGA AACC 
 in silico PCR Fragment
0001 TCACGTCCTG TGGGCCCGTA ACTATGCAAA GGATGTTAGG TTCGGGCCG- GAGGTGAGGG 
0061 CCATGATGCT GCAGGGAGTG GACGTGCTGG CGGATGCCGT G-GCCGTGAC CATGGGACCA 
0121 AAGGGACGCA ACGTGATCAT CGAGCAGAGC TGGGGATCGC CAAAGATTAC CAAGGACGGC 
0181 GTGACGGTGG CCAAGTCGAT TGCCCTCAAG GACAAGTTCC AGAATATCGG CGCCAAACTG 
0241 GTGCAGG-AT GTGGCGAACA ACACGAACGA GGAGGCAGGT GATGGCACCA CCACGGCCAC 
0301 CGTTCTGGCC CGCGCCATTG CCAAGGAG-G GATTCGAGAA GATTTCACGG GGTGCCAGTC 
0361 CGGTGGAGAT CCGCCGCGGA GTTATGCTAG CCATCGAGAC GGTCAAGGAC AACCTTCGTC 
0421 GGTTGTCCCG GCCAGTTAAC ACGCCCGAGG AGATCTGCCA GGTGGCGACG ATCTCTGCGA 
0481 ACGGCGACAA GTCGGTGGGA AACC 
 Assemble Data

7235R-2.IR_full       1   TCACGTCCTGTGGGCCCGTAACTATGCAAAGGATGTTAGGTTCGGGCCGAGAGGTGAGGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
7235R-2.in silico     1   TCACGTCCTGTGGGCCCGTAACTATGCAAAGGATGTTAGGTTCGGGCCG-GAGGTGAGGG 60


7235R-2.IR_full       61  CCATGATGCTGCAGGGAGTGGACGTGCTGGCGGATNNCGTGNGCCGTGACCATGGGACCA 120
                          |||||||||||||||||||||||||||||||||||  |||| ||||||||||||||||||
7235R-2.in silico     61  CCATGATGCTGCAGGGAGTGGACGTGCTGGCGGATGCCGTG-GCCGTGACCATGGGACCA 120


7235R-2.IR_full       121 AAGGGACGCAACGTGATCATCGAGCAGAGCTGGGGATCGCCAAAGATTACCAAGGACGGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7235R-2.in silico     121 AAGGGACGCAACGTGATCATCGAGCAGAGCTGGGGATCGCCAAAGATTACCAAGGACGGC 180


7235R-2.IR_full       181 GTGACGGTGGCCAAGTCGATTGCCCTCAAGGACAAGTTCCAGAATATCGGCGCCAAACTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7235R-2.in silico     181 GTGACGGTGGCCAAGTCGATTGCCCTCAAGGACAAGTTCCAGAATATCGGCGCCAAACTG 240


7235R-2.IR_full       241 GTGCAGGNATGTGGCGAACAACACGAACGAGGAGGCAGGTGATGGCACCACCACGGCCAC 300
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
7235R-2.in silico     241 GTGCAGG-ATGTGGCGAACAACACGAACGAGGAGGCAGGTGATGGCACCACCACGGCCAC 300


7235R-2.IR_full       301 CGTTCTGGCCCGCGCCATTGCCAAGGAGNGGATTCGAGAAGATTTCACGGGGTGCCAGTC 360
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
7235R-2.in silico     301 CGTTCTGGCCCGCGCCATTGCCAAGGAG-GGATTCGAGAAGATTTCACGGGGTGCCAGTC 360


7235R-2.IR_full       361 CGGTGGAGATCCGCCGCGGAGTTATGCTAGCCATCGAGACGGTCAAGGACAACCTTCGTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7235R-2.in silico     361 CGGTGGAGATCCGCCGCGGAGTTATGCTAGCCATCGAGACGGTCAAGGACAACCTTCGTC 420


7235R-2.IR_full       421 GGTTGTCCCGGCCAGTTAACACGCCCGAGGAGATCTGCCAGGTGGCGACGATCTCTGCGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7235R-2.in silico     421 GGTTGTCCCGGCCAGTTAACACGCCCGAGGAGATCTGCCAGGTGGCGACGATCTCTGCGA 480


7235R-2.IR_full       481 ACGGCGACAAGTCGGTGGGAAACC 504
                          ||||||||||||||||||||||||
7235R-2.in silico     481 ACGGCGACAAGTCGGTGGGAAACC 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164654.1  CG7235-RA, transcript variant A (Hsp60C), mRNA 
100   482  NM_135104.4  CG7235-RC, transcript variant C (Hsp60C), mRNA 
100   482  NM_164655.2  CG7235-RB, transcript variant B (Hsp60C), mRNA 
3.31   16  56  81  112  NM_167266.1  CG12101-RB, transcript variant B (Hsp60), mRNA 
3.31   16  56  81  112  NM_078560.2  CG12101-RA, transcript variant A (Hsp60), mRNA 
0.41   15  15  NM_135812.2  CG16954-RA, transcript variant A (Hsp60D), mRNA 
0.41   15  15  NM_165043.1  CG16954-RB, transcript variant B (Hsp60D), mRNA 
0   NM_142034.1  CG9764-RA (yrt), mRNA 
0   NM_080358.2  CG1484-RA (fliI), mRNA 
0   NM_138105.1  CG13594-RA (CG13594), mRNA 
0   11  NM_135247.2  CG9138-RA (SP1070), mRNA 
0   NM_140249.1  CG14131-RA (CG14131), mRNA 
0   NM_139498.1  CG9965-RA (CG9965), mRNA 
0   NM_001043160.1  CG41454-RA (CG41454), mRNA 
0   NM_164457.1  CG3166-RA, transcript variant A (aop), mRNA 
0   NM_078731.2  CG3166-RB, transcript variant B (aop), mRNA 
0   NM_130665.2  CG2680-RA (CG2680), mRNA 
0   NM_133020.2  CG6506-RA (CG6506), mRNA 
0   NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0   NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0   NM_135223.2  CG11199-RA, transcript variant A (Liprin-alpha), mRNA 
0   NM_164707.1  CG11199-RB, transcript variant B (Liprin-alpha), mRNA 
0   NM_057429.3  CG9703-RA, transcript variant A (Axs), mRNA 
0   NM_001038760.1  CG9703-RB, transcript variant B (Axs), mRNA 
0   NM_135309.1  CG7134-RA (CG7134), mRNA 
0   26  50  NM_080186.2  CG2830-RA (Hsp60B), mRNA 
0   12  NM_132296.2  CG7033-RA, transcript variant A (CG7033), mRNA 
0   12  NM_167176.1  CG7033-RB, transcript variant B (CG7033), mRNA 
0   12  NM_176715.1  CG7033-RC, transcript variant C (CG7033), mRNA 
0   NM_134929.2  CG3254-RA (pgant2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.