National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7213R-6 
 Symbol CG7213  Full Name CG7213 
 CG No CG7213  Old CG No CG7213 
 Synonyms CG7213 
 Accession No (Link to NCBI) NM_139938.2 
 Inserted Chr. lll 
 Insertional Mutation  2 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGGAGTGCAACTTTATGGA 
 Primer Seq. 3'
aatctagaggtaccCTAGAGCAACCACTTGGTGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAGGAGTGC AACTTTATGG AACTCATGGA GGAGATGGCC GTGCAGTTTA CGATGAACAA 
0061 GGAAGAACAT CAGCTCTTCG TTCACGACTC ACGCATGATA TCCCTGACCA TTCAGCAGCA 
0121 ATTGATCATG GATGGTGCGG TGTTCAAGGA CCATCTGGGA CAGCTCCACA GAACAGCCTC 
0181 CTTTGTCAAC AAAATGTACT TGGACATGCC GCTGAACTTT GAGATCTTTC TGCCCATNCC 
0241 GCCTGCCGGA GGCAGTGNGG TTCCCACCTA CGATGAGAAT AAACGCAGTG TGGAATTAAC 
0301 CAGAGCCAAC TGCCAGCACC CATTCTTCTT TGGGAATGCG GTAAATGTCA AATGTTTGAA 
0361 CCTGCTGCTN NAAAGCGAAC TGCAGCGAGC CATTTCAAAA GTGAAGACGG CATCATCCGT 
0421 ATGCTCGGGT CGGACGTACG ACATTAAGTA CTCGGTGCTG ACCTTCAACG ACGTGCCCTT 
0481 CGTTCACCAA GTGGTTGCTC TAG 
 in silico PCR Fragment
0001 GGAGGAGTGC AACTTTATGG AACTCATGGA GGAGATGGCC GTGCAGTTTA CGATGAACAA 
0061 GGAAGAACAT CAGCTCTTCG TTCACGACTC ACGCATGATA TCCCTGACCA TTCAGCAGCA 
0121 ATTGATCATG GATGGTGCGG TGTTCAAGGA CCATCTGGGA CAGCTCCACA GAACAGCCTC 
0181 CTTTGTCAAC AAAATGTACT TGGACATGCC GCTGAACTTT GAGATCTTTC TGCCCAT-CC 
0241 GCCTGCCGGA GGCAGT--GG TTCCCACCTA CGATGAGAAT AAACGCAGTG TGGAATTAAC 
0301 CAGAGCCAAC TGCCAGCACC CATTCTTCTT TGGGAATGCG GTAAATGTCA AATGTTTGAA 
0361 CCTGCTGCTG CAAAGCGAAC TGCAGCGAGC CATTTCAAAA GTGAAGACGG CATCATCCGT 
0421 ATGCTCGGGT CGGACGTACG ACATTAAGTA CTCGGTGCTG ACCTTCAACG ACGTGCCCTT 
0481 CGTTCACCAA GTGGTTGCTC TAG 
 Assemble Data

7213R-6.IR_full       1   GGAGGAGTGCAACTTTATGGAACTCATGGAGGAGATGGCCGTGCAGTTTACGATGAACAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7213R-6.in silico     1   GGAGGAGTGCAACTTTATGGAACTCATGGAGGAGATGGCCGTGCAGTTTACGATGAACAA 60


7213R-6.IR_full       61  GGAAGAACATCAGCTCTTCGTTCACGACTCACGCATGATATCCCTGACCATTCAGCAGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7213R-6.in silico     61  GGAAGAACATCAGCTCTTCGTTCACGACTCACGCATGATATCCCTGACCATTCAGCAGCA 120


7213R-6.IR_full       121 ATTGATCATGGATGGTGCGGTGTTCAAGGACCATCTGGGACAGCTCCACAGAACAGCCTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7213R-6.in silico     121 ATTGATCATGGATGGTGCGGTGTTCAAGGACCATCTGGGACAGCTCCACAGAACAGCCTC 180


7213R-6.IR_full       181 CTTTGTCAACAAAATGTACTTGGACATGCCGCTGAACTTTGAGATCTTTCTGCCCATNCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
7213R-6.in silico     181 CTTTGTCAACAAAATGTACTTGGACATGCCGCTGAACTTTGAGATCTTTCTGCCCAT-CC 240


7213R-6.IR_full       241 GCCTGCCGGAGGCAGTGNGGTTCCCACCTACGATGAGAATAAACGCAGTGTGGAATTAAC 300
                          ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||
7213R-6.in silico     241 GCCTGCCGGAGGCAGT--GGTTCCCACCTACGATGAGAATAAACGCAGTGTGGAATTAAC 300


7213R-6.IR_full       301 CAGAGCCAACTGCCAGCACCCATTCTTCTTTGGGAATGCGGTAAATGTCAAATGTTTGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7213R-6.in silico     301 CAGAGCCAACTGCCAGCACCCATTCTTCTTTGGGAATGCGGTAAATGTCAAATGTTTGAA 360


7213R-6.IR_full       361 CCTGCTGCTNNAAAGCGAACTGCAGCGAGCCATTTCAAAAGTGAAGACGGCATCATCCGT 420
                          |||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||
7213R-6.in silico     361 CCTGCTGCTGCAAAGCGAACTGCAGCGAGCCATTTCAAAAGTGAAGACGGCATCATCCGT 420


7213R-6.IR_full       421 ATGCTCGGGTCGGACGTACGACATTAAGTACTCGGTGCTGACCTTCAACGACGTGCCCTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7213R-6.in silico     421 ATGCTCGGGTCGGACGTACGACATTAAGTACTCGGTGCTGACCTTCAACGACGTGCCCTT 480


7213R-6.IR_full       481 CGTTCACCAAGTGGTTGCTCTAG 503
                          |||||||||||||||||||||||
7213R-6.in silico     481 CGTTCACCAAGTGGTTGCTCTAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139938.2  CG7213-RA (CG7213), mRNA 
0   NM_140949.1  CG6663-RA (CG6663), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   NM_140293.2  CG5645-RA (CG5645), mRNA 
0   NM_137507.3  CG5341-RA (sec6), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_001038766.1  CG32529-RD, transcript variant D (CG32529), mRNA 
0   NM_167688.1  CG32529-RC, transcript variant C (CG32529), mRNA 
0   NM_058047.3  CG7961-RA, transcript variant A (alphaCop), mRNA 
0   NM_167908.1  CG7961-RB, transcript variant B (alphaCop), mRNA 
0   NM_001015316.1  CG17514-PA.3 (CG17514), mRNA 
0   NM_165618.1  CG8579-RA (Jon44E), mRNA 
0   NM_140353.1  CG14120-RA (CG14120), mRNA 
0   11  NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_132335.2  CG12139-RB (CG12139), mRNA 
0   NM_142521.1  CG6026-RA (CG6026), mRNA 
0   NM_135799.2  CG9305-RA (CG9305), mRNA 
0   NM_143370.1  CG9989-RA (CG9989), mRNA 
0   NM_165873.2  CG13164-RC, transcript variant C (SIP2), mRNA 
0   NM_176152.1  CG13164-RG, transcript variant G (SIP2), mRNA 
0   NM_164950.1  CG31723-RA (CG31723), mRNA 
0   NM_136595.1  CG13744-RA (CG13744), mRNA 
0   NM_132836.1  CG8206-RA (CG8206), mRNA 
0   NM_164671.1  CG9088-RB, transcript variant B (lid), mRNA 
0   NM_078762.4  CG9088-RA, transcript variant A (lid), mRNA 
0   NM_079959.2  CG4501-RA (bgm), mRNA 
0   NM_057311.4  CG6246-RA (nub), mRNA 
0   NM_137573.2  CG10073-RA (CG10073), mRNA 
0   NM_167474.1  CG8909-RB (CG8909), mRNA 
0   NM_057362.2  CG17579-RA, transcript variant A (sca), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.