National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7203R-3 
 Symbol CG7203  Full Name CG7203 
 CG No CG7203  Old CG No CG7203 
 Synonyms CG7203 
 Accession No (Link to NCBI) NM_135299.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTTTCGTTTCAAGCGTCACTGAGATCACAAAAGCCAACATGAAGTTCGCCGTTGTCGTAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCCTGTTCGCTTTGGCCTGGGGTGTCAACAGCTCGGTGGTGCCTCTCCTGACCTCCGCCC 120

                          ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     121 ATGGTCTGGTGGTCGGTTCTCCCGCCGTCGCCGGT-TCGGTGGCCATCCAGGCATCTGCG 180

                          ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| silico     181 GTTCCCGCTGCCGTTCCCCTGTCCCTGTCCCCAGCCGGACCCGTGCTCATCCAGTCTGGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCAGCGGTGGTTGCCGCTCCCGTTCCCGCCGCTGTGGTTGCTGCCCACGCCCCCGCCGTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GTGGCCGTCGCCGCTCCGGAGGCCAGCTATGTGGCCAAGACCCGTGGAGCTGTCCATGTG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCTCCTCTGCCAGGACATGTGCAGTCCGCTGCTTCCGTGAACTTGGAACC 410

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   391  14  NM_135299.2  CG7203-RA (CG7203), mRNA 
1.27   13  12  14  NM_135297.2  CG7214-RA (CG7214), mRNA 
0.51   NM_132629.1  CG4330-RA (CG4330), mRNA 
0   NM_165169.3  CG5996-RB, transcript variant B (trpgamma), mRNA 
0   NM_135958.3  CG5996-RA, transcript variant A (trpgamma), mRNA 
0   NM_169854.1  CG31212-RA (CG31212), mRNA 
0   NM_137616.2  CG11208-RA (CG11208), mRNA 
0   25  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   25  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   25  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167854.2  CG32334-RA (CG32334), mRNA 
0   NM_140605.1  CG13047-RA (CG13047), mRNA 
0   27  NM_136533.1  CG11641-RA (pdm3), mRNA 
0   NM_001014617.1  CG7583-RE, transcript variant E (CtBP), mRNA 
0   18  NM_057767.3  CG7216-RA (Acp1), mRNA 
0   12  NM_164768.1  CG31904-RB, transcript variant B (CG31904), mRNA 
0   12  NM_164769.1  CG31904-RD, transcript variant D (CG31904), mRNA 
0   NM_168560.1  CG32132-RA (CG32132), mRNA 
0   NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_136582.2  CG8235-RA (CG8235), mRNA 
0   10  NM_206026.1  CG9403-RC, transcript variant C (jing), mRNA 
0   10  NM_136371.2  CG9403-RA, transcript variant A (jing), mRNA 
0   10  NM_206027.1  CG9403-RD, transcript variant D (jing), mRNA 
0   NM_057917.3  CG3943-RA (kraken), mRNA 
0   NM_141352.1  CG1075-RA (CG1075), mRNA 
0   NM_142322.1  CG18622-RA (CG18622), mRNA 
0   23  NM_165002.1  CG31762-RB, transcript variant B (aret), mRNA 
0   NM_142054.1  CG14365-RA (CG14365), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.