National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7203R-1 
 Symbol CG7203  Full Name CG7203 
 CG No CG7203  Old CG No CG7203 
 Synonyms CG7203 
 Accession No (Link to NCBI) NM_135299.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
This page was unable to retrieve journal information for the resources.
Please wait a few minutes and refresh this page.
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTTCGTTTCAAGCGTCACTG 
 Primer Seq. 3'
aatctagaggtaccGGTTCCAAGTTCACGGAAGCA 
 Predicted Fragment Size
409 
 IR fragment full Seq
0001 GTTTCGTTTC AAGCGTCACT GAGATCACAA AAGCCAACAT GAAGTTCGCC GTTGTCGTAG 
0061 TCCTGTTCGC TTTGGCCTGG GGTGTCAACA GCTCGGTGGT GCCTCTCCTG ACCTCCGCCC 
0121 ATGGTCTGGT GGTCGGTTCT CCCGCCGTCG CCGGTNTCGG TGGCCATCCA GGCATCTGCG 
0181 GTTCCNGCTG CCGTTCCTCT GTCCCTGTCC CCAGCCGGAC CCGTGCTCAT CCAGTCTGGA 
0241 CCAGCGGTGG TTGCCGCTCC CGTTCCCGCC GCTGTGGTTG CTGCCCACGC CCCCGCCGTG 
0301 GTGGCCGTCG CCGCTCCGGA gGCCAGCTAT GTGGCCAAGA CCCGTGGAGC TGTCCATGTG 
0361 GCTCCTCTGC CAGGACATGT GCAGTCCGCT GCTTCCGTGA ACTTGGAACC  
 in silico PCR Fragment
0001 GTTTCGTTTC AAGCGTCACT GAGATCACAA AAGCCAACAT GAAGTTCGCC GTTGTCGTAG 
0061 TCCTGTTCGC TTTGGCCTGG GGTGTCAACA GCTCGGTGGT GCCTCTCCTG ACCTCCGCCC 
0121 ATGGTCTGGT GGTCGGTTCT CCCGCCGTCG CCGGT-TCGG TGGCCATCCA GGCATCTGCG 
0181 GTTCCCGCTG CCGTTCCCCT GTCCCTGTCC CCAGCCGGAC CCGTGCTCAT CCAGTCTGGA 
0241 CCAGCGGTGG TTGCCGCTCC CGTTCCCGCC GCTGTGGTTG CTGCCCACGC CCCCGCCGTG 
0301 GTGGCCGTCG CCGCTCCGGA GGCCAGCTAT GTGGCCAAGA CCCGTGGAGC TGTCCATGTG 
0361 GCTCCTCTGC CAGGACATGT GCAGTCCGCT GCTTCCGTGA ACTTGGAACC  
 Assemble Data

7203R-1.IR_full       1   GTTTCGTTTCAAGCGTCACTGAGATCACAAAAGCCAACATGAAGTTCGCCGTTGTCGTAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7203R-1.in silico     1   GTTTCGTTTCAAGCGTCACTGAGATCACAAAAGCCAACATGAAGTTCGCCGTTGTCGTAG 60


7203R-1.IR_full       61  TCCTGTTCGCTTTGGCCTGGGGTGTCAACAGCTCGGTGGTGCCTCTCCTGACCTCCGCCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7203R-1.in silico     61  TCCTGTTCGCTTTGGCCTGGGGTGTCAACAGCTCGGTGGTGCCTCTCCTGACCTCCGCCC 120


7203R-1.IR_full       121 ATGGTCTGGTGGTCGGTTCTCCCGCCGTCGCCGGTNTCGGTGGCCATCCAGGCATCTGCG 180
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
7203R-1.in silico     121 ATGGTCTGGTGGTCGGTTCTCCCGCCGTCGCCGGT-TCGGTGGCCATCCAGGCATCTGCG 180


7203R-1.IR_full       181 GTTCCNGCTGCCGTTCCTCTGTCCCTGTCCCCAGCCGGACCCGTGCTCATCCAGTCTGGA 240
                          ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||
7203R-1.in silico     181 GTTCCCGCTGCCGTTCCCCTGTCCCTGTCCCCAGCCGGACCCGTGCTCATCCAGTCTGGA 240


7203R-1.IR_full       241 CCAGCGGTGGTTGCCGCTCCCGTTCCCGCCGCTGTGGTTGCTGCCCACGCCCCCGCCGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7203R-1.in silico     241 CCAGCGGTGGTTGCCGCTCCCGTTCCCGCCGCTGTGGTTGCTGCCCACGCCCCCGCCGTG 300


7203R-1.IR_full       301 GTGGCCGTCGCCGCTCCGGAGGCCAGCTATGTGGCCAAGACCCGTGGAGCTGTCCATGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7203R-1.in silico     301 GTGGCCGTCGCCGCTCCGGAGGCCAGCTATGTGGCCAAGACCCGTGGAGCTGTCCATGTG 360


7203R-1.IR_full       361 GCTCCTCTGCCAGGACATGTGCAGTCCGCTGCTTCCGTGAACTTGGAACC 410
                          ||||||||||||||||||||||||||||||||||||||||||||||||||
7203R-1.in silico     361 GCTCCTCTGCCAGGACATGTGCAGTCCGCTGCTTCCGTGAACTTGGAACC 410

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   391  14  NM_135299.2  CG7203-RA (CG7203), mRNA 
1.27   13  12  14  NM_135297.2  CG7214-RA (CG7214), mRNA 
0.51   NM_132629.1  CG4330-RA (CG4330), mRNA 
0   NM_165169.3  CG5996-RB, transcript variant B (trpgamma), mRNA 
0   NM_135958.3  CG5996-RA, transcript variant A (trpgamma), mRNA 
0   NM_169854.1  CG31212-RA (CG31212), mRNA 
0   NM_137616.2  CG11208-RA (CG11208), mRNA 
0   25  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   25  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   25  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167854.2  CG32334-RA (CG32334), mRNA 
0   NM_140605.1  CG13047-RA (CG13047), mRNA 
0   27  NM_136533.1  CG11641-RA (pdm3), mRNA 
0   NM_001014617.1  CG7583-RE, transcript variant E (CtBP), mRNA 
0   18  NM_057767.3  CG7216-RA (Acp1), mRNA 
0   12  NM_164768.1  CG31904-RB, transcript variant B (CG31904), mRNA 
0   12  NM_164769.1  CG31904-RD, transcript variant D (CG31904), mRNA 
0   NM_168560.1  CG32132-RA (CG32132), mRNA 
0   NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_136582.2  CG8235-RA (CG8235), mRNA 
0   10  NM_206026.1  CG9403-RC, transcript variant C (jing), mRNA 
0   10  NM_136371.2  CG9403-RA, transcript variant A (jing), mRNA 
0   10  NM_206027.1  CG9403-RD, transcript variant D (jing), mRNA 
0   NM_057917.3  CG3943-RA (kraken), mRNA 
0   NM_141352.1  CG1075-RA (CG1075), mRNA 
0   NM_142322.1  CG18622-RA (CG18622), mRNA 
0   23  NM_165002.1  CG31762-RB, transcript variant B (aret), mRNA 
0   NM_142054.1  CG14365-RA (CG14365), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
DM
VM
VB
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.