National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7196R-3 
 Symbol CG7196  Full Name CG7196 
 CG No CG7196  Old CG No CG7196 
 Synonyms CG7196 
 Accession No (Link to NCBI) NM_135301.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACATGAAGGAGCTGCGGGAAC 
 Primer Seq. 3'
aatctagaggtaccCTGGGATATGCGCAACGAACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACATGAAGGA GCTGCGGGAA CGAATTGACG AGGATTACCG CAAACAGCTG CTGTCCCGCA 
0061 TTCGCGCCCG GGAGTTAAAA GAAGTGGAGC GCGAACGAAT GCTGATTATC GAGGGCAAGT 
0121 CAGACGTAAT ACCAGACGAA CTAGCCAACG ATCCCATATT CATGGTTAAC AAAGATGCCA 
0181 ACATGGAGAT CCAAAAGGAG CGCTCCAAGC TGAAGACCGC TCGCGAGAAG AACGCGGAGC 
0241 GTTTGAAGCT GCAGGGCGTT AAATGGGAGC GGGAAAGGCT TCAACATGCC GCCAAGGAAG 
0301 CCGAACTGCT GGCCAAGAAA CGCGAGCGGC ACCGCCAACA GAAATTACTG GTGGAGCAGT 
0361 ACAGGACCGA GGATGCGGAG AGGGGAATGG ATCTGCTGCG CATCGATAAC GAAGACTGGC 
0421 GGGAGTGCGA AAAGAGCCTG AAGGAGTTCC TCGAACAGGA GCGTGCCAAA ATGAAGGAGC 
0481 GTTCGTTGCG CATATCCCAG  
 in silico PCR Fragment
0001 ACATGAAGGA GCTGCGGGAA CGAATTGACG AGGATTACCG CAAACAGCTG CTGTCCCGCA 
0061 TTCGCGCCCG GGAGTTAAAA GAAGTGGAGC GCGAACGAAT GCTGATTATC GAGGGCAAGT 
0121 CAGACGTAAT ACCAGACGAA CTAGCCAACG ATCCCATATT CATGGTTAAC AAAGATGCCA 
0181 ACATGGAGAT TCAAAAGGAG CGCTCCAAGC TGAAGACCGC TCGCGAGAAG AACGCGGAGC 
0241 GTTTGAAGCT GCAGGGCGTT AAATGGGAGC GGGAAAGGCT TCAACATGCC GCCAAGGAAG 
0301 CCGAACTGCT GGCCAAGAAA CGCGAGCGGC ACCGCCAACA GAAATTACTG GTGGAGCAGT 
0361 ACAGGACCGA GGATGCGGAG AGGGGAATGG ATCTGCTGCG CATCGATAAC GAAGACTGGC 
0421 GGGAGTGCGA AAAGAGCCTG AAGGAGTTCC TCGAACAGGA GCGTGCCAAA ATGAAGGAGC 
0481 GTTCGTTGCG CATATCCCAG  
 Assemble Data

7196R-3.IR_full       1   ACATGAAGGAGCTGCGGGAACGAATTGACGAGGATTACCGCAAACAGCTGCTGTCCCGCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7196R-3.in silico     1   ACATGAAGGAGCTGCGGGAACGAATTGACGAGGATTACCGCAAACAGCTGCTGTCCCGCA 60


7196R-3.IR_full       61  TTCGCGCCCGGGAGTTAAAAGAAGTGGAGCGCGAACGAATGCTGATTATCGAGGGCAAGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7196R-3.in silico     61  TTCGCGCCCGGGAGTTAAAAGAAGTGGAGCGCGAACGAATGCTGATTATCGAGGGCAAGT 120


7196R-3.IR_full       121 CAGACGTAATACCAGACGAACTAGCCAACGATCCCATATTCATGGTTAACAAAGATGCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7196R-3.in silico     121 CAGACGTAATACCAGACGAACTAGCCAACGATCCCATATTCATGGTTAACAAAGATGCCA 180


7196R-3.IR_full       181 ACATGGAGATCCAAAAGGAGCGCTCCAAGCTGAAGACCGCTCGCGAGAAGAACGCGGAGC 240
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
7196R-3.in silico     181 ACATGGAGATTCAAAAGGAGCGCTCCAAGCTGAAGACCGCTCGCGAGAAGAACGCGGAGC 240


7196R-3.IR_full       241 GTTTGAAGCTGCAGGGCGTTAAATGGGAGCGGGAAAGGCTTCAACATGCCGCCAAGGAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7196R-3.in silico     241 GTTTGAAGCTGCAGGGCGTTAAATGGGAGCGGGAAAGGCTTCAACATGCCGCCAAGGAAG 300


7196R-3.IR_full       301 CCGAACTGCTGGCCAAGAAACGCGAGCGGCACCGCCAACAGAAATTACTGGTGGAGCAGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7196R-3.in silico     301 CCGAACTGCTGGCCAAGAAACGCGAGCGGCACCGCCAACAGAAATTACTGGTGGAGCAGT 360


7196R-3.IR_full       361 ACAGGACCGAGGATGCGGAGAGGGGAATGGATCTGCTGCGCATCGATAACGAAGACTGGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7196R-3.in silico     361 ACAGGACCGAGGATGCGGAGAGGGGAATGGATCTGCTGCGCATCGATAACGAAGACTGGC 420


7196R-3.IR_full       421 GGGAGTGCGAAAAGAGCCTGAAGGAGTTCCTCGAACAGGAGCGTGCCAAAATGAAGGAGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7196R-3.in silico     421 GGGAGTGCGAAAAGAGCCTGAAGGAGTTCCTCGAACAGGAGCGTGCCAAAATGAAGGAGC 480


7196R-3.IR_full       481 GTTCGTTGCGCATATCCCAG 500
                          ||||||||||||||||||||
7196R-3.in silico     481 GTTCGTTGCGCATATCCCAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135301.2  CG7196-RA, transcript variant A (CG7196), mRNA 
17.21   83  NM_164770.1  CG7196-RB, transcript variant B (CG7196), mRNA 
0   NM_057629.3  CG4379-RA, transcript variant A (Pka-C1), mRNA 
0   NM_164866.1  CG4379-RB, transcript variant B (Pka-C1), mRNA 
0   NM_205950.1  CG4379-RC, transcript variant C (Pka-C1), mRNA 
0   NM_135691.1  CG6734-RA (CG6734), mRNA 
0   NM_164871.1  CG4079-RA (Taf11), mRNA 
0   NM_134584.2  CG32512-RA (CG32512), mRNA 
0   NM_057786.3  CG7434-RA (RpL22), mRNA 
0   NM_164556.1  CG10021-RA, transcript variant A (bowl), mRNA 
0   NM_164558.1  CG10021-RD, transcript variant D (bowl), mRNA 
0   NM_057535.2  CG10021-RC, transcript variant C (bowl), mRNA 
0   NM_164557.1  CG10021-RB, transcript variant B (bowl), mRNA 
0   NM_057741.3  CG4720-RA, transcript variant A (Pk92B), mRNA 
0   NM_206518.1  CG4720-RB, transcript variant B (Pk92B), mRNA 
0   NM_132308.1  CG12106-RA (CG12106), mRNA 
0   NM_142989.3  CG6413-RA (Dis3), mRNA 
0   NM_168151.1  CG10480-RB, transcript variant B (Bj1), mRNA 
0   NM_168152.1  CG10480-RC, transcript variant C (Bj1), mRNA 
0   NM_079219.2  CG10480-RA, transcript variant A (Bj1), mRNA 
0   NM_142359.2  CG31256-RA (Brf), mRNA 
0   NM_132983.1  CG8664-RA (CG8664), mRNA 
0   NM_078849.1  CG11861-RA, transcript variant A (gft), mRNA 
0   NM_165110.1  CG11861-RB, transcript variant B (gft), mRNA 
0   NM_165111.1  CG11861-RC, transcript variant C (gft), mRNA 
0   NM_133138.1  CG7884-RA (CG7884), mRNA 
0   NM_080020.3  CG11491-RE, transcript variant E (br), mRNA 
0   NM_166898.1  CG11491-RG, transcript variant G (br), mRNA 
0   NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
0   NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.