National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7171R-1 
 Symbol Uro  Full Name Urate oxidase 
 CG No CG7171  Old CG No CG7171 
 Synonyms UOX, uro, UO, Dm UO, OU, Uo, CG7171, anon-WO0140519.210, Uro 
 Accession No (Link to NCBI) NM_057431.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACCACCAGACCCCAAAGAAT 
 Primer Seq. 3'
aatctagaggtaccGTGGGCGTGAATATAAAAGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AACCACCAGA CCCCAAAGAA TTCCGCCGGC ATGGATGAGC ATGGTAAGCC GTATCAGTAC 
0061 GAGATTACCG ATCACGGATA CGGCAAGGAT GCGGTCAAGG TGCTGCATGT CAGCCGCAAC 
0121 GGACCCGTGC ACGCCATCCA GGAATTCGAG GTGGGCACTC ACCTGAAGTT GTACAGCAAA 
0181 AAGGATTACT ACCAGGGCAA CAACTCGGAC ATCGTGGCCA CCGATTCGCA GAAGAACACC 
0241 GTCTATTTGC TGGCGAAAAA GCATGGCATT GAAAGTCCCG AGAAGTTTGC TCTGCTCCTG 
0301 GCCAGGCACT TTATTAACAA ATACTCGCAC GTGGAGGAGG CGCACGTTCA TGTGGAGGCG 
0361 TATNCCCTGG CAGCGAGTTT GCCAGGAGGA GACCAGGACC AACGTCAATG GGAAGTGCGA 
0421 GAACGGAGTC CAAGGGAACT GCGACTTCAG CTCCATTGAC AACAGATCAC TGCACAATCA 
0481 CGCTTTTATA TTCACGCCCA C 
 in silico PCR Fragment
0001 AACCACCAGA CCCCAAAGAA TTCCGCCGGC ATGGATGAGC ATGGTAAGCC GTATCAGTAC 
0061 GAGATTACCG ATCACGGATA CGGCAAGGAT GCGGTCAAGG TGCTGCATGT CAGCCGCAAC 
0121 GGACCCGTGC ACGCCATCCA GGAATTCGAG GTGGGCACTC ACCTGAAGTT GTACAGCAAA 
0181 AAGGATTACT ACCAGGGCAA CAACTCGGAC ATCGTGGCCA CCGATTCGCA GAAGAACACC 
0241 GTCTATTTGC TGGCGAAAAA GCATGGCATT GAAAGTCCCG AGAAGTTTGC TCTGCTCCTG 
0301 GCCAGGCACT TTATTAACAA ATACTCGCAC GTGGAGGAGG CGCACGTTCA TGTGGAGGCG 
0361 TAT-CCCTGG CAGCGAGTTT GCCAGGAGGA GACCAGGACC AACGTCAATG GGAAGTGCGA 
0421 GAACGGAGTC CAAGGGAACT GCGACTTCAG CTCCATTGAC AACAGATCAC TGCACAATCA 
0481 CGCTTTTATA TTCACGCCCA C 
 Assemble Data

7171R-1.IR_full       1   AACCACCAGACCCCAAAGAATTCCGCCGGCATGGATGAGCATGGTAAGCCGTATCAGTAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7171R-1.in silico     1   AACCACCAGACCCCAAAGAATTCCGCCGGCATGGATGAGCATGGTAAGCCGTATCAGTAC 60


7171R-1.IR_full       61  GAGATTACCGATCACGGATACGGCAAGGATGCGGTCAAGGTGCTGCATGTCAGCCGCAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7171R-1.in silico     61  GAGATTACCGATCACGGATACGGCAAGGATGCGGTCAAGGTGCTGCATGTCAGCCGCAAC 120


7171R-1.IR_full       121 GGACCCGTGCACGCCATCCAGGAATTCGAGGTGGGCACTCACCTGAAGTTGTACAGCAAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7171R-1.in silico     121 GGACCCGTGCACGCCATCCAGGAATTCGAGGTGGGCACTCACCTGAAGTTGTACAGCAAA 180


7171R-1.IR_full       181 AAGGATTACTACCAGGGCAACAACTCGGACATCGTGGCCACCGATTCGCAGAAGAACACC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7171R-1.in silico     181 AAGGATTACTACCAGGGCAACAACTCGGACATCGTGGCCACCGATTCGCAGAAGAACACC 240


7171R-1.IR_full       241 GTCTATTTGCTGGCGAAAAAGCATGGCATTGAAAGTCCCGAGAAGTTTGCTCTGCTCCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7171R-1.in silico     241 GTCTATTTGCTGGCGAAAAAGCATGGCATTGAAAGTCCCGAGAAGTTTGCTCTGCTCCTG 300


7171R-1.IR_full       301 GCCAGGCACTTTATTAACAAATACTCGCACGTGGAGGAGGCGCACGTTCATGTGGAGGCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7171R-1.in silico     301 GCCAGGCACTTTATTAACAAATACTCGCACGTGGAGGAGGCGCACGTTCATGTGGAGGCG 360


7171R-1.IR_full       361 TATNCCCTGGCAGCGAGTTTGCCAGGAGGAGACCAGGACCAACGTCAATGGGAAGTGCGA 420
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7171R-1.in silico     361 TAT-CCCTGGCAGCGAGTTTGCCAGGAGGAGACCAGGACCAACGTCAATGGGAAGTGCGA 420


7171R-1.IR_full       421 GAACGGAGTCCAAGGGAACTGCGACTTCAGCTCCATTGACAACAGATCACTGCACAATCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7171R-1.in silico     421 GAACGGAGTCCAAGGGAACTGCGACTTCAGCTCCATTGACAACAGATCACTGCACAATCA 480


7171R-1.IR_full       481 CGCTTTTATATTCACGCCCAC 501
                          |||||||||||||||||||||
7171R-1.in silico     481 CGCTTTTATATTCACGCCCAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057431.2  CG7171-RA (Uro), mRNA 
0   NM_137648.2  CG13434-RA (CG13434), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_079483.2  CG7405-RA (CycH), mRNA 
0   NM_175958.1  CG15444-RC, transcript variant C (ine), mRNA 
0   NM_175959.1  CG15444-RD, transcript variant D (ine), mRNA 
0   NM_057664.4  CG15444-RB, transcript variant B (ine), mRNA 
0   NM_080141.2  CG10120-RB, transcript variant B (Men), mRNA 
0   NM_169479.1  CG10120-RA, transcript variant A (Men), mRNA 
0   NM_079268.2  CG10923-RA (Klp67A), mRNA 
0   NM_136727.2  CG18408-RA, transcript variant A (CAP), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_136805.1  CG13215-RA (CG13215), mRNA 
0   NM_143282.2  CG5880-RA (CG5880), mRNA 
0   NM_170184.1  CG6238-RB, transcript variant B (ssh), mRNA 
0   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   NM_079100.2  CG17632-RA (bw), mRNA 
0   NM_135270.1  CG5177-RA (CG5177), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_130662.2  CG2662-RA (CG2662), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_137269.2  CG7747-RA (CG7747), mRNA 
0   NM_137971.2  CG5428-RA (CG5428), mRNA 
0   NM_206237.1  CG12022-RA (CG12022), mRNA 
0   NM_079384.2  CG4314-RA (st), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.