National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7160R-3 
 Symbol Cpr78E  Full Name Cuticular protein 78E 
 CG No CG7160  Old CG No CG7160 
 Synonyms BcDNA:LP06027, Cpr78E, CG7160 
 Accession No (Link to NCBI) NM_141088.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zoolog Sci (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTAAGATTCTCATCGTCGCCC 
 Primer Seq. 3'
aatctagaggtaccGACCTTAGGAGGCTTAGCATA 
 Predicted Fragment Size
407 
 IR fragment full Seq
0001 TTAAGATTCT CATCGTCGCC CTGTCCCTTT GCACGGCCGT CGTGCTGAGT GCTCCAGTGG 
0061 ACCACGTCAC ATCCACCACC CAGCCACCGG TGGCCATTCT CGAATCATCT CACGAAAAGC 
0121 ACGAGGATGG ATCGTACAAC TTCTCTTACC TCGGCGAGGA CGGCACCCAC AGAAGGGAGG 
0181 AGGCCGTGGT CAGAAACCAA GGCACCGAGA ACGAGTACCT GGAGATCAGC GGCTCCTACT 
0241 CCTACTTCGA TGCCAACGGA CAGGAGGTGA CCGTCACCTA CAAGGCCGAT GACCACGGAT 
0301 TTGTACCAGA GGGCGGAGNA ATCCTGCCCC AGATTTCGCT GGCCGCCAAG CAGGTCAGCG 
0361 AGCAGGTGCC CCAACCAGAT CTTGACTATG CTAAGCCTCC TAAGGTC 
 in silico PCR Fragment
0001 TTAAGATTCT CATCGTCGCC CTGTCCCTTT GCACGGCCGT CGTGCTGAGT GCTCCAGTGG 
0061 ACCACGTCAC ATCCACCACC CAGCCACCGG TGGCCATTCT CGAATCATCT CACGAAAAGC 
0121 ACGAGGATGG ATCGTACAAC TTCTCTTACC TCGGCGAGGA CGGCACCCAC AGAAGGGAGG 
0181 AGGCCGTGGT CAGAAACCAA GGCACCGAGA ACGAGTACCT GGAGATCAGC GGCTCCTACT 
0241 CCTACTTCGA TGCCAACGGA CAGGAGGTGA CCGTCACCTA CAAGGCCGAT GACCACGGAT 
0301 TTGTACCAGA GGGCGGAGCA ATCCTGCCCC AGATTTCGCT GGCCGCCAAG CAGGTCAGCG 
0361 AGCAGGTGCC CCAACCAGAT CTTGACTATG CTAAGCCTCC TAAGGTC 
 Assemble Data

7160R-3.IR_full       1   TTAAGATTCTCATCGTCGCCCTGTCCCTTTGCACGGCCGTCGTGCTGAGTGCTCCAGTGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7160R-3.in silico     1   TTAAGATTCTCATCGTCGCCCTGTCCCTTTGCACGGCCGTCGTGCTGAGTGCTCCAGTGG 60


7160R-3.IR_full       61  ACCACGTCACATCCACCACCCAGCCACCGGTGGCCATTCTCGAATCATCTCACGAAAAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7160R-3.in silico     61  ACCACGTCACATCCACCACCCAGCCACCGGTGGCCATTCTCGAATCATCTCACGAAAAGC 120


7160R-3.IR_full       121 ACGAGGATGGATCGTACAACTTCTCTTACCTCGGCGAGGACGGCACCCACAGAAGGGAGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7160R-3.in silico     121 ACGAGGATGGATCGTACAACTTCTCTTACCTCGGCGAGGACGGCACCCACAGAAGGGAGG 180


7160R-3.IR_full       181 AGGCCGTGGTCAGAAACCAAGGCACCGAGAACGAGTACCTGGAGATCAGCGGCTCCTACT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7160R-3.in silico     181 AGGCCGTGGTCAGAAACCAAGGCACCGAGAACGAGTACCTGGAGATCAGCGGCTCCTACT 240


7160R-3.IR_full       241 CCTACTTCGATGCCAACGGACAGGAGGTGACCGTCACCTACAAGGCCGATGACCACGGAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7160R-3.in silico     241 CCTACTTCGATGCCAACGGACAGGAGGTGACCGTCACCTACAAGGCCGATGACCACGGAT 300


7160R-3.IR_full       301 TTGTACCAGAGGGCGGAGNAATCCTGCCCCAGATTTCGCTGGCCGCCAAGCAGGTCAGCG 360
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
7160R-3.in silico     301 TTGTACCAGAGGGCGGAGCAATCCTGCCCCAGATTTCGCTGGCCGCCAAGCAGGTCAGCG 360


7160R-3.IR_full       361 AGCAGGTGCCCCAACCAGATCTTGACTATGCTAAGCCTCCTAAGGTC 407
                          |||||||||||||||||||||||||||||||||||||||||||||||
7160R-3.in silico     361 AGCAGGTGCCCCAACCAGATCTTGACTATGCTAAGCCTCCTAAGGTC 407

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   389  NM_141088.1  CG7160-RA (CG7160), mRNA 
0   NM_166535.1  CG4444-RA (px), mRNA 
0   NM_167943.1  CG32304-RA (CG32304), mRNA 
0   NM_136557.2  CG8635-RA (CG8635), mRNA 
0   NM_136172.2  CG10680-RA (CG10680), mRNA 
0   NM_136516.2  CG8708-RA, transcript variant A (CG8708), mRNA 
0   NM_165594.1  CG8708-RB, transcript variant B (CG8708), mRNA 
0   NM_141779.2  CG6621-RA (CG6621), mRNA 
0   NM_135156.2  CG13991-RA (CG13991), mRNA 
0   NM_080273.2  CG18817-RA, transcript variant A (Tsp42Ea), mRNA 
0   NM_144389.1  CG18817-RB, transcript variant B (Tsp42Ea), mRNA 
0   NM_142648.2  CG5494-RA (CG5494), mRNA 
0   NM_165502.1  CG18817-RC, transcript variant C (Tsp42Ea), mRNA 
0   NM_132575.2  CG2560-RA (CG2560), mRNA 
0   NM_144403.1  CG18777-RA (CG18777), mRNA 
0   NM_137795.1  CG6613-RA (CG6613), mRNA 
0   NM_137047.2  CG6197-RA (CG6197), mRNA 
0   NM_133141.1  CG7992-RA (CG7992), mRNA 
0   NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   NM_138195.2  CG12169-RA (CG12169), mRNA 
0   NM_132622.1  CG18646-RA (CG18646), mRNA 
0   NM_057469.3  CG10718-RA (neb), mRNA 
0   117  NM_001015110.1  CG40323-PB.3 (CG40323), mRNA 
0   NM_142935.1  CG13601-RA (CG13601), mRNA 
0   NM_164681.1  CG9175-RB, transcript variant B (CG9175), mRNA 
0   NM_135151.2  CG9175-RA, transcript variant A (CG9175), mRNA 
0   NM_164944.1  CG31869-RA (CG31869), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_001038817.1  CG4551-RD, transcript variant D (smi35A), mRNA 
0   NM_001038818.1  CG4551-RE, transcript variant E (smi35A), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.