National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7152R-2 
 Symbol Syn1  Full Name Syntrophin-like 1 
 CG No CG7152  Old CG No CG7152 
 Synonyms CG7152, CG7151, DmSYN-1, Syn1 
 Accession No (Link to NCBI) NM_168937.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Marrone AK, Edeleva EV, Kucherenko MM, Hsiao NH, Shcherbata HR.
Dg-Dys-Syn1 signaling in Drosophila regulates the microRNA profile.
BMC Cell Biol. (2012) 13 26 [ PubMed ID = 23107381 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGCCCTACTTTCG-GAAGGCAAGCATCATCTCGGAAGTGGGTTGGGAGCTCCAGCGGGC- 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTTCCTCTGTCCGCTGGGACCAGGCGTACCCACGTCGCCGCCCGCCCCCAAGACGACACC 120

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     121 CCGGGCGGATACGCGATACATCCCGCTGCAGC-TGACGCATCTGGCCAGGAATCTCAAAT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACATCGACCCGGAAAACCGGTGCTTCGAGTTGCATTCGCCCGACGGAGTGCACTCCTGCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCCTGCGGGCAGCGGACTCGGCGGAGGCCCTCGTCTGGTTCAATGCCCTCCACTCGGCGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGGGCACCAGCACGCAGCGCGCTTTGGCCGAGGCCAATCGGGCGCTTACCAACCTCATCG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCGAACTGAAGCACATTGGATGGCTGAGCAAGCGGATGAGCGGCGGAGGAAGTTCTGGTA 420

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     421 GCGCCGGGGGCGGAGCGGCTAGCGGAGGCAGCGGCACCTCGAACAG-CGTTGTAGCCGGC 480

                          |||||||||||||||||||||||||||||| silico     481 GAGTTGGTAAGTCCCAGCGGTCGTTCCAGT 510

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   488  NM_079481.2  CG7152-RB, transcript variant B (Syn1), mRNA 
100   488  NM_168937.2  CG7152-RA, transcript variant A (Syn1), mRNA 
0   NM_135207.2  CG11319-RA (CG11319), mRNA 
0   NM_142696.1  CG7000-RA (CG7000), mRNA 
0   12  NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   12  NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   12  NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   NM_135766.2  CG16974-RA (CG16974), mRNA 
0   NM_130578.2  CG32809-RD, transcript variant D (CG32809), mRNA 
0   NM_166899.1  CG32809-RB, transcript variant B (CG32809), mRNA 
0   NM_001043270.1  CG5621-RB, transcript variant B (CG5621), mRNA 
0   NM_142670.2  CG5621-RA, transcript variant A (CG5621), mRNA 
0   NM_142432.2  CG7985-RA (CG7985), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0   NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   NM_167563.2  CG5424-RA, transcript variant A (f), mRNA 
0   NM_058053.3  CG6939-RA, transcript variant A (Sbf), mRNA 
0   NM_169430.2  CG6939-RB, transcript variant B (Sbf), mRNA 
0   NM_169659.2  CG14869-RA, transcript variant A (CG14869), mRNA 
0   NM_206496.1  CG14869-RB, transcript variant B (CG14869), mRNA 
0   NM_165147.1  CG4894-RD, transcript variant D (Ca-alpha1D), mRNA 
0   NM_134429.2  CG4894-RA, transcript variant A (Ca-alpha1D), mRNA 
0   NM_165146.1  CG4894-RC, transcript variant C (Ca-alpha1D), mRNA 
0   NM_080365.2  CG4894-RB, transcript variant B (Ca-alpha1D), mRNA 
0   NM_078559.2  CG18085-RA (sev), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.