National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7152R-1 
 Symbol Syn1  Full Name Syntrophin-like 1 
 CG No CG7152  Old CG No CG7152 
 Synonyms CG7152, CG7151, DmSYN-1, Syn1 
 Accession No (Link to NCBI) NM_168937.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nagai R, Hashimoto R, Yamaguchi M.
Drosophila Syntrophins are involved in locomotion and regulation of synaptic morphology.
Exp. Cell Res. (2010) 316(14) 2313-21 [ PubMed ID = 20632467 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCCCTACTTTCGGAAGGCAA 
 Primer Seq. 3'
aatctagaggtaccACTGGAACGACCGCTGGGCAA 
 Predicted Fragment Size
506 
 IR fragment full Seq
0001 CGCCCTACTT TCGTGAAGGC AAGCATCATC TCGGAAGTGG GTTGGGAGCT CCAGCGGGCT 
0061 CTTCCTCTGT CCGCTGGGAC CAGGCGTACC CACGTCGCCG CCCGCCCCCA AGACGACACC 
0121 CCGGGCGGAT ACGCGATACA TCCCGCTGCA GCATGACGCA TCTGGCCAGG AATCTCAAAT 
0181 ACATCGACCC GGAAAACCGG TGCTTCGAGT TGCATTCGCC CGACGGAGTG CACTCCTGCA 
0241 TCCTGCGGGC AGCGGACTCG GCGGAGGCCC TCGTCTGGTT CAATGCCCTC CACTCGGCGA 
0301 TGGGCACCAG CACGCAGCGC GCTTTGGCCG AGGCCAATCG GGCGCTTACC AACCTCATCG 
0361 GCGAACTGAA GCACATTGGA TGGCTGAGCA AGCGGATGAG CGGCGGAGGA AGTTCTGGTA 
0421 GCGCCGGGGG CGGAGCGGCT AGCGGAGGCA GCGGCACCTC GAACAGACGT TGTAGCCGGC 
0481 GAGTTGgtaa gtCCCAGCGG TCGTTCCAGT  
 in silico PCR Fragment
0001 CGCCCTACTT TCG-GAAGGC AAGCATCATC TCGGAAGTGG GTTGGGAGCT CCAGCGGGC- 
0061 CTTCCTCTGT CCGCTGGGAC CAGGCGTACC CACGTCGCCG CCCGCCCCCA AGACGACACC 
0121 CCGGGCGGAT ACGCGATACA TCCCGCTGCA GC-TGACGCA TCTGGCCAGG AATCTCAAAT 
0181 ACATCGACCC GGAAAACCGG TGCTTCGAGT TGCATTCGCC CGACGGAGTG CACTCCTGCA 
0241 TCCTGCGGGC AGCGGACTCG GCGGAGGCCC TCGTCTGGTT CAATGCCCTC CACTCGGCGA 
0301 TGGGCACCAG CACGCAGCGC GCTTTGGCCG AGGCCAATCG GGCGCTTACC AACCTCATCG 
0361 GCGAACTGAA GCACATTGGA TGGCTGAGCA AGCGGATGAG CGGCGGAGGA AGTTCTGGTA 
0421 GCGCCGGGGG CGGAGCGGCT AGCGGAGGCA GCGGCACCTC GAACAG-CGT TGTAGCCGGC 
0481 GAGTTGGTAA GTCCCAGCGG TCGTTCCAGT  
 Assemble Data

7152R-1.IR_full       1   CGCCCTACTTTCGTGAAGGCAAGCATCATCTCGGAAGTGGGTTGGGAGCTCCAGCGGGCT 60
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| 
7152R-1.in silico     1   CGCCCTACTTTCG-GAAGGCAAGCATCATCTCGGAAGTGGGTTGGGAGCTCCAGCGGGC- 60


7152R-1.IR_full       61  CTTCCTCTGTCCGCTGGGACCAGGCGTACCCACGTCGCCGCCCGCCCCCAAGACGACACC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7152R-1.in silico     61  CTTCCTCTGTCCGCTGGGACCAGGCGTACCCACGTCGCCGCCCGCCCCCAAGACGACACC 120


7152R-1.IR_full       121 CCGGGCGGATACGCGATACATCCCGCTGCAGCATGACGCATCTGGCCAGGAATCTCAAAT 180
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
7152R-1.in silico     121 CCGGGCGGATACGCGATACATCCCGCTGCAGC-TGACGCATCTGGCCAGGAATCTCAAAT 180


7152R-1.IR_full       181 ACATCGACCCGGAAAACCGGTGCTTCGAGTTGCATTCGCCCGACGGAGTGCACTCCTGCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7152R-1.in silico     181 ACATCGACCCGGAAAACCGGTGCTTCGAGTTGCATTCGCCCGACGGAGTGCACTCCTGCA 240


7152R-1.IR_full       241 TCCTGCGGGCAGCGGACTCGGCGGAGGCCCTCGTCTGGTTCAATGCCCTCCACTCGGCGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7152R-1.in silico     241 TCCTGCGGGCAGCGGACTCGGCGGAGGCCCTCGTCTGGTTCAATGCCCTCCACTCGGCGA 300


7152R-1.IR_full       301 TGGGCACCAGCACGCAGCGCGCTTTGGCCGAGGCCAATCGGGCGCTTACCAACCTCATCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7152R-1.in silico     301 TGGGCACCAGCACGCAGCGCGCTTTGGCCGAGGCCAATCGGGCGCTTACCAACCTCATCG 360


7152R-1.IR_full       361 GCGAACTGAAGCACATTGGATGGCTGAGCAAGCGGATGAGCGGCGGAGGAAGTTCTGGTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7152R-1.in silico     361 GCGAACTGAAGCACATTGGATGGCTGAGCAAGCGGATGAGCGGCGGAGGAAGTTCTGGTA 420


7152R-1.IR_full       421 GCGCCGGGGGCGGAGCGGCTAGCGGAGGCAGCGGCACCTCGAACAGACGTTGTAGCCGGC 480
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7152R-1.in silico     421 GCGCCGGGGGCGGAGCGGCTAGCGGAGGCAGCGGCACCTCGAACAG-CGTTGTAGCCGGC 480


7152R-1.IR_full       481 GAGTTGGTAAGTCCCAGCGGTCGTTCCAGT 510
                          ||||||||||||||||||||||||||||||
7152R-1.in silico     481 GAGTTGGTAAGTCCCAGCGGTCGTTCCAGT 510

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   488  NM_079481.2  CG7152-RB, transcript variant B (Syn1), mRNA 
100   488  NM_168937.2  CG7152-RA, transcript variant A (Syn1), mRNA 
0   NM_135207.2  CG11319-RA (CG11319), mRNA 
0   NM_142696.1  CG7000-RA (CG7000), mRNA 
0   12  NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   12  NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   12  NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   NM_135766.2  CG16974-RA (CG16974), mRNA 
0   NM_130578.2  CG32809-RD, transcript variant D (CG32809), mRNA 
0   NM_166899.1  CG32809-RB, transcript variant B (CG32809), mRNA 
0   NM_001043270.1  CG5621-RB, transcript variant B (CG5621), mRNA 
0   NM_142670.2  CG5621-RA, transcript variant A (CG5621), mRNA 
0   NM_142432.2  CG7985-RA (CG7985), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0   NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   NM_167563.2  CG5424-RA, transcript variant A (f), mRNA 
0   NM_058053.3  CG6939-RA, transcript variant A (Sbf), mRNA 
0   NM_169430.2  CG6939-RB, transcript variant B (Sbf), mRNA 
0   NM_169659.2  CG14869-RA, transcript variant A (CG14869), mRNA 
0   NM_206496.1  CG14869-RB, transcript variant B (CG14869), mRNA 
0   NM_165147.1  CG4894-RD, transcript variant D (Ca-alpha1D), mRNA 
0   NM_134429.2  CG4894-RA, transcript variant A (Ca-alpha1D), mRNA 
0   NM_165146.1  CG4894-RC, transcript variant C (Ca-alpha1D), mRNA 
0   NM_080365.2  CG4894-RB, transcript variant B (Ca-alpha1D), mRNA 
0   NM_078559.2  CG18085-RA (sev), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.