National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7149R-2 
 Symbol CG7149  Full Name CG7149 
 CG No CG7149  Old CG No CG7149 
 Synonyms CG7149 
 Accession No (Link to NCBI) NM_135305.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTTCCTCAGCGTCTATGTG 
 Primer Seq. 3'
aatctagaggtaccATGGTAAAGTCGTAACCCCAG 
 Predicted Fragment Size
491 
 IR fragment full Seq
0001 AGCTTCCTCA GCGTCTATGT GATGCACCCT TTTTGGAACT ACTGTGTGAA GTTTGTTCCC 
0061 AAATGGCTGG CGCCCAACGT TTTGACCTTC GTGGGCTTTC TCATGACTGT CGTCAACTTT 
0121 ATCCTGATAG CTTACTATGA TTGGGGTTTC GAAGCAGCCA ATTCAGAGAC AGGAAATACG 
0181 GTGCCCGCCT GGNTTTGGAC AGTGGCGGCC ATAAATATAC TCATTTACTA CAACTTGGAT 
0241 GGCATGGATG GCAAGCAGGC TCGAAGAACT GGAACGAGTG GACCTCTGGG AGAGCTATTC 
0301 GATCATGGAT TGGACNCCTA TTCAGCTGCC CTGATACCCA TTTACCTATT CTCCTTATTC 
0361 GGCACACACG ACTTGCCACC GATTCGTATG TTCTTTGTGA TCTGGAACGT ATTTCTCAAC 
0421 TTCTATTTAA CGCACGTGGA AAAGTACAAT ACGGGTGTTA TGTTCTTGCC CTGGGGTTAC 
0481 GACTTTACCA T 
 in silico PCR Fragment
0001 AGCTTCCTCA GCGTCTATGT GATGCACCCT TTTTGGAACT ACTGTGTGAA GTTTGTTCCC 
0061 AAATGGCTGG CGCCCAACGT TTTGACCTTC GTGGGCTTTC TCATGACTGT CGTCAACTTT 
0121 ATCCTGATAG CTTACTATGA TTGGGGTTTC GAAGCAGCCA ATTCAGAGAC AGGAAATACG 
0181 GTGCCCGCCT GGGTTTGGAC AGTGGCGGCC ATAAATATAC TCATTTACTA CAACTTGGAT 
0241 GGCATGGATG GCAAGCAGGC TCGAAGAACT GGAACGAGTG GACCTCTGGG AGAGCTATTC 
0301 GATCATGGAT TGGACTCCTA TTCAGCTGCC CTGATACCCA TTTACCTATT CTCCTTATTC 
0361 GGCACACACG ACTTGCCACC GATTCGTATG TTCTTTGTGA TCTGGAACGT ATTTCTCAAC 
0421 TTCTATTTAA CGCACGTGGA AAAGTACAAT ACGGGTGTTA TGTTCTTGCC CTGGGGTTAC 
0481 GACTTTACCA T 
 Assemble Data

7149R-2.IR_full       1   AGCTTCCTCAGCGTCTATGTGATGCACCCTTTTTGGAACTACTGTGTGAAGTTTGTTCCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7149R-2.in silico     1   AGCTTCCTCAGCGTCTATGTGATGCACCCTTTTTGGAACTACTGTGTGAAGTTTGTTCCC 60


7149R-2.IR_full       61  AAATGGCTGGCGCCCAACGTTTTGACCTTCGTGGGCTTTCTCATGACTGTCGTCAACTTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7149R-2.in silico     61  AAATGGCTGGCGCCCAACGTTTTGACCTTCGTGGGCTTTCTCATGACTGTCGTCAACTTT 120


7149R-2.IR_full       121 ATCCTGATAGCTTACTATGATTGGGGTTTCGAAGCAGCCAATTCAGAGACAGGAAATACG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7149R-2.in silico     121 ATCCTGATAGCTTACTATGATTGGGGTTTCGAAGCAGCCAATTCAGAGACAGGAAATACG 180


7149R-2.IR_full       181 GTGCCCGCCTGGNTTTGGACAGTGGCGGCCATAAATATACTCATTTACTACAACTTGGAT 240
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
7149R-2.in silico     181 GTGCCCGCCTGGGTTTGGACAGTGGCGGCCATAAATATACTCATTTACTACAACTTGGAT 240


7149R-2.IR_full       241 GGCATGGATGGCAAGCAGGCTCGAAGAACTGGAACGAGTGGACCTCTGGGAGAGCTATTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7149R-2.in silico     241 GGCATGGATGGCAAGCAGGCTCGAAGAACTGGAACGAGTGGACCTCTGGGAGAGCTATTC 300


7149R-2.IR_full       301 GATCATGGATTGGACNCCTATTCAGCTGCCCTGATACCCATTTACCTATTCTCCTTATTC 360
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
7149R-2.in silico     301 GATCATGGATTGGACTCCTATTCAGCTGCCCTGATACCCATTTACCTATTCTCCTTATTC 360


7149R-2.IR_full       361 GGCACACACGACTTGCCACCGATTCGTATGTTCTTTGTGATCTGGAACGTATTTCTCAAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7149R-2.in silico     361 GGCACACACGACTTGCCACCGATTCGTATGTTCTTTGTGATCTGGAACGTATTTCTCAAC 420


7149R-2.IR_full       421 TTCTATTTAACGCACGTGGAAAAGTACAATACGGGTGTTATGTTCTTGCCCTGGGGTTAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7149R-2.in silico     421 TTCTATTTAACGCACGTGGAAAAGTACAATACGGGTGTTATGTTCTTGCCCTGGGGTTAC 480


7149R-2.IR_full       481 GACTTTACCAT 491
                          |||||||||||
7149R-2.in silico     481 GACTTTACCAT 491

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   473  NM_135305.3  CG7149-RA (CG7149), mRNA 
0   NM_142344.1  CG4053-RA (CG4053), mRNA 
0   NM_133013.1  CG15816-RA (CG15816), mRNA 
0   NM_137049.2  CG12464-RA (CG12464), mRNA 
0   NM_166238.2  CG4853-RA, transcript variant A (CG4853), mRNA 
0   NM_137378.2  CG4853-RB, transcript variant B (CG4853), mRNA 
0   NM_079035.2  CG3666-RA (Tsf3), mRNA 
0   NM_139934.3  CG8006-RA (CG8006), mRNA 
0   NM_166639.1  CG3725-RH, transcript variant H (Ca-P60A), mRNA 
0   32  NM_176060.1  CG33116-RA (CG33116), mRNA 
0   NM_136130.3  CG18094-RA (CG18094), mRNA 
0   NM_170376.1  CG9990-RB, transcript variant B (CG9990), mRNA 
0   NM_057511.3  CG3936-RA (N), mRNA 
0   NM_167022.1  CG32771-RA (CG32771), mRNA 
0   NM_057744.2  CG1708-RA (cos), mRNA 
0   NM_135667.3  CG6614-RA (CG6614), mRNA 
0   NM_165090.1  CG31835-RA (CG31835), mRNA 
0   NM_143189.1  CG8957-RA (CG8957), mRNA 
0   NM_206603.1  CG3056-RB, transcript variant B (CG3056), mRNA 
0   NM_130552.2  CG3056-RA, transcript variant A (CG3056), mRNA 
0   NM_170399.1  CG11897-RA, transcript variant A (CG11897), mRNA 
0   NM_143421.2  CG11897-RB, transcript variant B (CG11897), mRNA 
0   NM_143783.2  CG5824-RA (l(3)07882), mRNA 
0   NM_079017.2  CG8542-RA (Hsc70-5), mRNA 
0   NM_168590.1  CG9628-RB, transcript variant B (CG9628), mRNA 
0   NM_133004.1  CG8211-RA (CG8211), mRNA 
0   NM_139707.1  CG15214-RA (CG15214), mRNA 
0   NM_142037.1  CG14370-RA (CG14370), mRNA 
0   NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_057512.3  CG3724-RA (Pgd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.