National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7146R-2 
 Symbol CG7146  Full Name CG7146 
 CG No CG7146  Old CG No CG7146 
 Synonyms CG7146 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCAACCATGTCATCTTGGG 
 Primer Seq. 3'
aatctagaggtaccGCTTCTTTGGTGCTTTTCCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCAACCAT GTCATCTTGG GCACCCGCAG CGNACAGTGA TCATGTACTC TGTGGACGAG 
0061 GAGACGGGCG TGGACATGCG GATGTTCAAC AAGAACTTCA GCCGGAAACC GATCACCCAA 
0121 ATGGAAGTGA TTGCCTCGGA GAACCTGCTC TTCGTACTCA CCGACTTACA GGTGCAGGTG 
0181 TGCGACATTC GGCGGATTGA GAGCAACTTC GCTTTCATGC ACAGTGCGCC CGACACGAAG 
0241 GGATGCACCC TGTTCACCAT GGACGTGGAC ACGCCGAAGT CCACAACCGG ACGTGTGGCC 
0301 ACCGTCATAC GGGTGTGCTG CGNTATCCGG CGGCGTCTTG TGTTCTTCTT TTGGAAGGAG 
0361 GACAAGCTTA ATTCCCTGGA ATTGANCATC GAGCTCAGCG ATGTGCCCAG GACACTGTGC 
0421 TGGGTGGGCC ATGCTGTCTG CGTGGGCTTC AAAGACGAAT ATGTTGTTTA CGATATATCA 
0481 GGAAAAGCAC CAAAGAANN 
 in silico PCR Fragment
0001 TGGCAACCAT GTCATCTTGG GCACCCGCAG CGGACAGCTG ATCATGTACT CTGTGGACGA 
0061 GGAGACGGGC GTGGACATGC GGATGTTCAA CAAGAACTTC AGCCGGAAAC CGATCACCCA 
0121 AATGGAAGTG ATTGCCTCGG AGAACCTGCT CTTCGTACTC ACCGACTTAC AGGTGCAGGT 
0181 GTGCGACATT CGGCGGATTG AGAGCAACTT CGCTTTCATG CACAGTGCGC CCGACACGAA 
0241 GGGATGCACC CTGTTCACCA TGGACGTGGA CACGCCGAAG TCCACAACCG GACGTGTGGC 
0301 CACCGTCATA CGGGTGTGCT GCGCTATCCG GCGGCGTCTT GTGTTCTTCT TTTGGAAGGA 
0361 GGACAAGCTT AATTCCCTGG AATTGATCAT CGAGCTCAGC GATGTGCCCA GGACACTGTG 
0421 CTGGGTGGGC CATGCTGTCT GCGTGGGCTT CAAAGACGAA TATGTTGTTT ACGATATATC 
0481 AGGAAAAGCA CCAAAGAAGC  
 Assemble Data

7146R-2.IR full       1   TGGCAACCATGTCATCTTGGGCACCCGCAGCGNACAG-TGATCATGTACTCTGTGGACGA 60
                          |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||
7146R-2.in silico     1   TGGCAACCATGTCATCTTGGGCACCCGCAGCGGACAGCTGATCATGTACTCTGTGGACGA 60


7146R-2.IR full       61  GGAGACGGGCGTGGACATGCGGATGTTCAACAAGAACTTCAGCCGGAAACCGATCACCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7146R-2.in silico     61  GGAGACGGGCGTGGACATGCGGATGTTCAACAAGAACTTCAGCCGGAAACCGATCACCCA 120


7146R-2.IR full       121 AATGGAAGTGATTGCCTCGGAGAACCTGCTCTTCGTACTCACCGACTTACAGGTGCAGGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7146R-2.in silico     121 AATGGAAGTGATTGCCTCGGAGAACCTGCTCTTCGTACTCACCGACTTACAGGTGCAGGT 180


7146R-2.IR full       181 GTGCGACATTCGGCGGATTGAGAGCAACTTCGCTTTCATGCACAGTGCGCCCGACACGAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7146R-2.in silico     181 GTGCGACATTCGGCGGATTGAGAGCAACTTCGCTTTCATGCACAGTGCGCCCGACACGAA 240


7146R-2.IR full       241 GGGATGCACCCTGTTCACCATGGACGTGGACACGCCGAAGTCCACAACCGGACGTGTGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7146R-2.in silico     241 GGGATGCACCCTGTTCACCATGGACGTGGACACGCCGAAGTCCACAACCGGACGTGTGGC 300


7146R-2.IR full       301 CACCGTCATACGGGTGTGCTGCGNTATCCGGCGGCGTCTTGTGTTCTTCTTTTGGAAGGA 360
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
7146R-2.in silico     301 CACCGTCATACGGGTGTGCTGCGCTATCCGGCGGCGTCTTGTGTTCTTCTTTTGGAAGGA 360


7146R-2.IR full       361 GGACAAGCTTAATTCCCTGGAATTGANCATCGAGCTCAGCGATGTGCCCAGGACACTGTG 420
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
7146R-2.in silico     361 GGACAAGCTTAATTCCCTGGAATTGATCATCGAGCTCAGCGATGTGCCCAGGACACTGTG 420


7146R-2.IR full       421 CTGGGTGGGCCATGCTGTCTGCGTGGGCTTCAAAGACGAATATGTTGTTTACGATATATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7146R-2.in silico     421 CTGGGTGGGCCATGCTGTCTGCGTGGGCTTCAAAGACGAATATGTTGTTTACGATATATC 480


7146R-2.IR full       481 AGGAAAAGCACCAAAGAANN 500
                          ||||||||||||||||||  
7146R-2.in silico     481 AGGAAAAGCACCAAAGAAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.