National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7145R-1 
 Symbol CG7145  Full Name CG7145 
 CG No CG7145  Old CG No CG7145 
 Synonyms CG7145 
 Accession No (Link to NCBI) NM_168942.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGAAGTTCCTCCTCCAGATGC 
 Primer Seq. 3'
aatctagaggtaccGCTGAATCGATTTCCGCCTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGAAGTTCCT CCTCCAGATG CTCTAGTCTT CAGCAGAGCT TGTTGAAAAG TTCGACACGC 
0061 TGTCTGGGTT CCGTTATACC GGACCTTAAA CTGAAGGACT TCCCGATCGC CAATGAGCCA 
0121 ATCCTGGGAT ATCTCAAGGA CTCTAAGGAG CGTAAGGCCC TCGAGCAGGC TCTAAAGGGC 
0181 ACGGCCNTCG AGTTGCGAAG ACATCCCCAT CGTGATCGGC GGCAAGGAGT ACAAGACGCC 
0241 GGAGGTTCGA TACCAGGTCA TGCCCCATGA CCACCAACAC AAGCTGGCCA GCTTCTACTA 
0301 CGCCGACAAG AAGCTTATCG AGAAGGCCAT CAAAACGGCG GTGGAAACAC AGCCCAAGTG 
0361 GGACCGTGTG TCGATTGCAG ACCGTCTGAA GATCTGGGAG AAGGCAGCGG ACCTAATGGC 
0421 AACGACGTAC CGCCAGGATC TCAACGCCGC CACCATGCTG GGTCAGTCAA AGACGGCGAT 
0481 TCAGGCGGAA ATCGATTCAG C 
 in silico PCR Fragment
0001 CGAAGTTCCT CCTCCAGATG CTCTAGTCTT CAGCAGAGCT TGTTGAAAAG TTCGACACGC 
0061 TGTCTGGGTT CCGTTATACC GGACCTTAAA CTGAAGGACT TCCCGATCGC CAATGAGCCA 
0121 ATCCTGGGAT ATCTCAAGGA CTCTAAGGAG CGTAAGGCCC TCGAGCAGGC TCTAAAGGGC 
0181 ACGGCC-TCG AGTTGCGAAG ACATCCCCAT CGTGATCGGC GGCAAGGAGT ACAAGACGCC 
0241 GGAGGTTCGA TACCAGGTCA TGCCCCATGA CCACCAACAC AAGCTGGCCA GCTTCTACTA 
0301 CGCCGACAAG AAGCTTATCG AGAAGGCCAT CAAAACGGCG GTGGAAACAC AGCCCAAGTG 
0361 GGACCGTGTG TCGATTGCAG ACCGTCTGAA GATCTGGGAG AAGGCAGCGG ACCTAATGGC 
0421 AACGACGTAC CGCCAGGATC TCAACGCCGC CACCATGCTG GGTCAGTCAA AGACGGCGAT 
0481 TCAGGCGGAA ATCGATTCAG C 
 Assemble Data

7145R-1.IR_full       1   CGAAGTTCCTCCTCCAGATGCTCTAGTCTTCAGCAGAGCTTGTTGAAAAGTTCGACACGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7145R-1.in silico     1   CGAAGTTCCTCCTCCAGATGCTCTAGTCTTCAGCAGAGCTTGTTGAAAAGTTCGACACGC 60


7145R-1.IR_full       61  TGTCTGGGTTCCGTTATACCGGACCTTAAACTGAAGGACTTCCCGATCGCCAATGAGCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7145R-1.in silico     61  TGTCTGGGTTCCGTTATACCGGACCTTAAACTGAAGGACTTCCCGATCGCCAATGAGCCA 120


7145R-1.IR_full       121 ATCCTGGGATATCTCAAGGACTCTAAGGAGCGTAAGGCCCTCGAGCAGGCTCTAAAGGGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7145R-1.in silico     121 ATCCTGGGATATCTCAAGGACTCTAAGGAGCGTAAGGCCCTCGAGCAGGCTCTAAAGGGC 180


7145R-1.IR_full       181 ACGGCCNTCGAGTTGCGAAGACATCCCCATCGTGATCGGCGGCAAGGAGTACAAGACGCC 240
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
7145R-1.in silico     181 ACGGCC-TCGAGTTGCGAAGACATCCCCATCGTGATCGGCGGCAAGGAGTACAAGACGCC 240


7145R-1.IR_full       241 GGAGGTTCGATACCAGGTCATGCCCCATGACCACCAACACAAGCTGGCCAGCTTCTACTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7145R-1.in silico     241 GGAGGTTCGATACCAGGTCATGCCCCATGACCACCAACACAAGCTGGCCAGCTTCTACTA 300


7145R-1.IR_full       301 CGCCGACAAGAAGCTTATCGAGAAGGCCATCAAAACGGCGGTGGAAACACAGCCCAAGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7145R-1.in silico     301 CGCCGACAAGAAGCTTATCGAGAAGGCCATCAAAACGGCGGTGGAAACACAGCCCAAGTG 360


7145R-1.IR_full       361 GGACCGTGTGTCGATTGCAGACCGTCTGAAGATCTGGGAGAAGGCAGCGGACCTAATGGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7145R-1.in silico     361 GGACCGTGTGTCGATTGCAGACCGTCTGAAGATCTGGGAGAAGGCAGCGGACCTAATGGC 420


7145R-1.IR_full       421 AACGACGTACCGCCAGGATCTCAACGCCGCCACCATGCTGGGTCAGTCAAAGACGGCGAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7145R-1.in silico     421 AACGACGTACCGCCAGGATCTCAACGCCGCCACCATGCTGGGTCAGTCAAAGACGGCGAT 480


7145R-1.IR_full       481 TCAGGCGGAAATCGATTCAGC 501
                          |||||||||||||||||||||
7145R-1.in silico     481 TCAGGCGGAAATCGATTCAGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168942.3  CG7145-RA, transcript variant A (CG7145), mRNA 
100   482  NM_168945.3  CG7145-RD, transcript variant D (CG7145), mRNA 
100   482  NM_141111.4  CG7145-RB, transcript variant B (CG7145), mRNA 
0   NM_132311.2  CG12119-RA (CG12119), mRNA 
0   NM_057984.3  CG3460-RA (Nmd3), mRNA 
0   NM_144058.2  CG30158-RA (CG30158), mRNA 
0   NM_080356.2  CG5993-RA (os), mRNA 
0   NM_142432.2  CG7985-RA (CG7985), mRNA 
0   NM_138049.2  CG3328-RA (CG3328), mRNA 
0   NM_166922.1  CG4199-RB, transcript variant B (CG4199), mRNA 
0   NM_130620.2  CG4199-RD, transcript variant D (CG4199), mRNA 
0   NM_166923.1  CG4199-RC, transcript variant C (CG4199), mRNA 
0   NM_166921.1  CG4199-RE, transcript variant E (CG4199), mRNA 
0   NM_166924.1  CG4199-RF, transcript variant F (CG4199), mRNA 
0   NR_002550.1  CR33655, miscRNA 
0   NM_137733.2  CG9485-RC, transcript variant C (CG9485), mRNA 
0   NM_166444.1  CG9485-RB, transcript variant B (CG9485), mRNA 
0   NM_166443.1  CG9485-RA, transcript variant A (CG9485), mRNA 
0   NM_141433.2  CG1104-RA, transcript variant A (CG1104), mRNA 
0   NM_169165.1  CG1104-RB, transcript variant B (CG1104), mRNA 
0   NM_141109.1  CG7148-RA (CG7148), mRNA 
0   NM_132881.2  CG3415-RA (CG3415), mRNA 
0   NM_079035.2  CG3666-RA (Tsf3), mRNA 
0   NM_164859.1  CG3838-RA, transcript variant A (CG3838), mRNA 
0   NM_135454.4  CG3838-RB, transcript variant B (CG3838), mRNA 
0   NM_079866.2  CG1744-RA (chp), mRNA 
0   NM_137380.2  CG4866-RA (CG4866), mRNA 
0   NM_137918.2  CG12192-RA (Klp59D), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_164887.1  CG31714-RA (CG31714), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.