National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7144R-1 
 Symbol CG7144  Full Name CG7144 
 CG No CG7144  Old CG No CG7144 
 Synonyms BEST:CK02318, CK02318, anon-WO0149856.1, CG7144 
 Accession No (Link to NCBI) NM_135306.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGCACTTCATCTGCTCGAAC 
 Primer Seq. 3'
aatctagaggtaccGGCATATTTGCCAAAGGCCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGCACTTCA TCTGCTCGAA CTGATCCCAC AAAGCTGCCG AAACATGTGG CGAGTGATTC 
0061 AACTGCGCGC AACAATCGCG CANCCGTTCA CCAGACAACG TCATAGTCGA GTGATTGCCA 
0121 TTCgGNGAGA GGATCAGTCG GTGTGGGAGC GACGAGctcC GTNTTGGACC AACCCACGTC 
0181 CAGAAGTTGG TCAAGCAGAA TGTCAAGGTC ATAGTGCAGC CGTCCAATCG TCGTGNCCTA 
0241 CCCCCATGNC AGGNCCTACN ATGNCAGGCT GGAGCTCATA TTCAGGGAAG GACATCNAGT 
0301 GATGCTTCGG TGNATATTCG GAGTGAAACC AGGNTGCCCA TAGNATGCAC TGATTCCTGG 
0361 GAAGACCTAC TGCTTCTTTT CVCACACGAT TAAAGCGCAG GAATCAAATA TGCCGCNTTC 
0421 TGGATGCTAT TTTGGAGAAG AAAATTCGGC TCATCGACTA TGAGCGAATC ATCGACNGAA 
0481 CGCGGANCAC GACAAGGGTG GCCTTTGGCA AATTATTCC 
 in silico PCR Fragment
0001 TCGCACTTCA TCTGCTCGAA CTGATCCCAC AAAGCTGCCG AAACATGTGG CGAGTGATTC 
0061 AACTGCGCGC AACAATCGCG CATCCGTTCA CCAGACAACG TCATAGTCGA GTGATTGCCA 
0121 TTCGGCGAGA GGATCAGTCG GTGTGGGAGC GACGAGCTCC GT-TTGGACC AACCCACGTC 
0181 CAGAAGTTGG TCAAGCAGAA TGTCAAGGTC ATAGTGCAGC CGTCCAATCG TCGTG-CCTA 
0241 -CCCCATG-C AGG-CCTAC- ATG-CAGGCT GGAGCTCATA TTCAGG--AG GACATC-AGT 
0301 GATGCTTCGG TG-ATATTCG GAGTGAAA-C AGG-TGCCCA TAG-ATGCAC TGATTCCTGG 
0361 GAAGACCTAC TGCTTCTTTT CGCACACGAT TAAAGCGCAG GAATCAAATA TGCCGC-TTT 
0421 TGGATGCTAT TTTGGAGAAG AAAATTCGGC TCATCGACTA TGAGCGAATC ATCGAC-GAA 
0481 CGCGGAGCAC GACA--GGTG GCCTTTGGCA AA-TATGCC 
 Assemble Data

7144R-1.IR_full       1   TCGCACTTCATCTGCTCGAACTGATCCCACAAAGCTGCCGAAACATGTGGCGAGTGATTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7144R-1.in silico     1   TCGCACTTCATCTGCTCGAACTGATCCCACAAAGCTGCCGAAACATGTGGCGAGTGATTC 60


7144R-1.IR_full       61  AACTGCGCGCAACAATCGCGCANCCGTTCACCAGACAACGTCATAGTCGAGTGATTGCCA 120
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
7144R-1.in silico     61  AACTGCGCGCAACAATCGCGCATCCGTTCACCAGACAACGTCATAGTCGAGTGATTGCCA 120


7144R-1.IR_full       121 TTCGGNGAGAGGATCAGTCGGTGTGGGAGCGACGAGCTCCGTNTTGGACCAACCCACGTC 180
                          ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||
7144R-1.in silico     121 TTCGGCGAGAGGATCAGTCGGTGTGGGAGCGACGAGCTCCGT-TTGGACCAACCCACGTC 180


7144R-1.IR_full       181 CAGAAGTTGGTCAAGCAGAATGTCAAGGTCATAGTGCAGCCGTCCAATCGTCGTGNCCTA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
7144R-1.in silico     181 CAGAAGTTGGTCAAGCAGAATGTCAAGGTCATAGTGCAGCCGTCCAATCGTCGTG-CCTA 240


7144R-1.IR_full       241 CCCCCATGNCAGGNCCTACNATGNCAGGCTGGAGCTCATATTCAGGGAAGGACATCNAGT 300
                           ||||||| |||| ||||| ||| ||||||||||||||||||||||  |||||||| |||
7144R-1.in silico     241 -CCCCATG-CAGG-CCTAC-ATG-CAGGCTGGAGCTCATATTCAGG--AGGACATC-AGT 300


7144R-1.IR_full       301 GATGCTTCGGTGNATATTCGGAGTGAAACCAGGNTGCCCATAGNATGCACTGATTCCTGG 360
                          |||||||||||| ||||||||||||||| |||| ||||||||| ||||||||||||||||
7144R-1.in silico     301 GATGCTTCGGTG-ATATTCGGAGTGAAA-CAGG-TGCCCATAG-ATGCACTGATTCCTGG 360


7144R-1.IR_full       361 GAAGACCTACTGCTTCTTTTCVCACACGATTAAAGCGCAGGAATCAAATATGCCGCNTTC 420
                          ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || 
7144R-1.in silico     361 GAAGACCTACTGCTTCTTTTCGCACACGATTAAAGCGCAGGAATCAAATATGCCGC-TTT 420


7144R-1.IR_full       421 TGGATGCTATTTTGGAGAAGAAAATTCGGCTCATCGACTATGAGCGAATCATCGACNGAA 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
7144R-1.in silico     421 TGGATGCTATTTTGGAGAAGAAAATTCGGCTCATCGACTATGAGCGAATCATCGAC-GAA 480


7144R-1.IR_full       481 CGCGGANCACGACAAGGGTGGCCTTTGGCAAATTATTCC 519
                          |||||| |||||||  |||||||||||||||| ||| ||
7144R-1.in silico     481 CGCGGAGCACGACA--GGTGGCCTTTGGCAAA-TATGCC 519

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135306.2  CG7144-RA (CG7144), mRNA 
0.2   NM_166316.1  CG12758-RC, transcript variant C (sano), mRNA 
0.2   NM_079064.2  CG12758-RD, transcript variant D (sano), mRNA 
0.2   NM_166315.1  CG12758-RB, transcript variant B (sano), mRNA 
0.2   NM_166314.1  CG12758-RA, transcript variant A (sano), mRNA 
0   NM_132131.2  CG14435-RA (CG14435), mRNA 
0   NM_079551.2  CG7494-RA (mRpL1), mRNA 
0   NM_137133.2  CG10143-RA (Adgf-E), mRNA 
0   NM_136102.2  CG10689-RA (CG10689), mRNA 
0   NM_134722.1  CG14339-RA (CG14339), mRNA 
0   NM_135866.2  CG7532-RA (CG7532), mRNA 
0   NM_134302.1  CG10719-RB, transcript variant B (brat), mRNA 
0   NM_142644.1  CG5466-RA (CG5466), mRNA 
0   NM_166179.2  CG4905-RA, transcript variant A (Syn2), mRNA 
0   NM_166181.2  CG4905-RD, transcript variant D (Syn2), mRNA 
0   NM_166180.2  CG4905-RB, transcript variant B (Syn2), mRNA 
0   NM_079038.3  CG4905-RC, transcript variant C (Syn2), mRNA 
0   NM_176201.1  CG4905-RE, transcript variant E (Syn2), mRNA 
0   NM_139528.2  CG17569-RB, transcript variant B (gry), mRNA 
0   NM_168000.1  CG17569-RA, transcript variant A (gry), mRNA 
0   NM_176749.1  CG8611-RB, transcript variant B (CG8611), mRNA 
0   NM_132986.4  CG8611-RA, transcript variant A (CG8611), mRNA 
0   NM_079092.2  CG2956-RA, transcript variant A (twi), mRNA 
0   NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_138118.2  CG3880-RA (CG3880), mRNA 
0   NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_001038878.1  CG2956-RB, transcript variant B (twi), mRNA 
0   NM_164400.1  CG31923-RA (CG31923), mRNA 
0   NM_164598.1  CG2950-RA, transcript variant A (CG2950), mRNA 
0   NM_164599.1  CG2950-RC, transcript variant C (CG2950), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.