National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7142R-4 
 Symbol CG7142  Full Name CG7142 
 CG No CG7142  Old CG No CG7142 
 Synonyms SP132, CG7142 
 Accession No (Link to NCBI) NM_142446.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAATGGCCATGAATTTGGCG 
 Primer Seq. 3'
aatctagaggtaccTTGCCCCAGCCGTACAAAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAATGGCCA TGAATTTGGC GGCCTACGGG CTGCTGGAGA ATCGGATTAG CACTCTGGAA 
0061 GCACCGCNNC AAACGCACTG GACGAAAAAG TTCCTGGCCA AGCGGGAGGC GACTCCCCAT 
0121 TCGGCGCCGT ATGTGGTCAG CATCCAGATG ATGACACCCG ATCAGGNACT GGTCCACTAC 
0181 TGTGCCGGCA CCATCATCAA CGAGCACTGG ATCCTGACGG CGGCCCACTG CCTCAAGCTC 
0241 ACCGCAGGCG GTGGAGAACT CGGTCATTGT GGCGGGCAGC CACGATATTC ACGATCAGAA 
0301 GGGCGAGGCG AGCAACATTC AAATGCGACA CATCGACTAC TACGTGCGAC ACGAGCTCTA 
0361 TCTCGGCGGA GTGAATCCCT ACGACATCGC GCTAATTTAC ACCAAGGAGC CCCTGGTCTT 
0421 TGACACCTAT GTCCAGCCAG CAACGCTGCC GGAGCAGGAT GCCCAGCCGG AGGGATATGG 
0481 AACTTTGTAC GGCTGGGGCA A 
 in silico PCR Fragment
0001 ACAATGGCCA TGAATTTGGC GGCCTACGGG CTGCTGGAGA ATCGGATTAG CACTCTGGAA 
0061 GCACCGCGAC AAACGCACTG GACGAAAAAG TTCCTGGCCA AGCGGGAGGC GACTCCCCAT 
0121 TCGGCGCCGT ATGTGGTCAG CATCCAGATG ATGACACCCG ATCAGGGACT GGTCCACTAC 
0181 TGTGCCGGCA CCATCATCAA CGAGCACTGG ATCCTGACGG CGGCCCACTG CCTC-AGCTC 
0241 ACCGCAGGCG GTGGAGAACT CGGTCATTGT GGCGGGCAGC CACGATATTC ACGATCAGAA 
0301 GGGCGAGGCG AGCAACATTC AAATGCGACA CATCGACTAC TACGTGCGAC ACGAGCTCTA 
0361 TCTCGGCGGA GTGAATCCCT ACGACATCGC GCTAATTTAC ACCAAGGAGC CCCTGGTCTT 
0421 TGACACCTAT GTCCAGCCAG CAACGCTGCC GGAGCAGGAT GCCCAGCCGG AGGGATATGG 
0481 AACTTTGTAC GGCTGGGGCA A 
 Assemble Data

7142R-4.IR_full       1   ACAATGGCCATGAATTTGGCGGCCTACGGGCTGCTGGAGAATCGGATTAGCACTCTGGAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7142R-4.in silico     1   ACAATGGCCATGAATTTGGCGGCCTACGGGCTGCTGGAGAATCGGATTAGCACTCTGGAA 60


7142R-4.IR_full       61  GCACCGCNNCAAACGCACTGGACGAAAAAGTTCCTGGCCAAGCGGGAGGCGACTCCCCAT 120
                          |||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||
7142R-4.in silico     61  GCACCGCGACAAACGCACTGGACGAAAAAGTTCCTGGCCAAGCGGGAGGCGACTCCCCAT 120


7142R-4.IR_full       121 TCGGCGCCGTATGTGGTCAGCATCCAGATGATGACACCCGATCAGGNACTGGTCCACTAC 180
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7142R-4.in silico     121 TCGGCGCCGTATGTGGTCAGCATCCAGATGATGACACCCGATCAGGGACTGGTCCACTAC 180


7142R-4.IR_full       181 TGTGCCGGCACCATCATCAACGAGCACTGGATCCTGACGGCGGCCCACTGCCTCAAGCTC 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
7142R-4.in silico     181 TGTGCCGGCACCATCATCAACGAGCACTGGATCCTGACGGCGGCCCACTGCCTC-AGCTC 240


7142R-4.IR_full       241 ACCGCAGGCGGTGGAGAACTCGGTCATTGTGGCGGGCAGCCACGATATTCACGATCAGAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7142R-4.in silico     241 ACCGCAGGCGGTGGAGAACTCGGTCATTGTGGCGGGCAGCCACGATATTCACGATCAGAA 300


7142R-4.IR_full       301 GGGCGAGGCGAGCAACATTCAAATGCGACACATCGACTACTACGTGCGACACGAGCTCTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7142R-4.in silico     301 GGGCGAGGCGAGCAACATTCAAATGCGACACATCGACTACTACGTGCGACACGAGCTCTA 360


7142R-4.IR_full       361 TCTCGGCGGAGTGAATCCCTACGACATCGCGCTAATTTACACCAAGGAGCCCCTGGTCTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7142R-4.in silico     361 TCTCGGCGGAGTGAATCCCTACGACATCGCGCTAATTTACACCAAGGAGCCCCTGGTCTT 420


7142R-4.IR_full       421 TGACACCTATGTCCAGCCAGCAACGCTGCCGGAGCAGGATGCCCAGCCGGAGGGATATGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7142R-4.in silico     421 TGACACCTATGTCCAGCCAGCAACGCTGCCGGAGCAGGATGCCCAGCCGGAGGGATATGG 480


7142R-4.IR_full       481 AACTTTGTACGGCTGGGGCAA 501
                          |||||||||||||||||||||
7142R-4.in silico     481 AACTTTGTACGGCTGGGGCAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142446.2  CG7142-RA (CG7142), mRNA 
0.2   NM_138127.1  CG3650-RA (CG3650), mRNA 
0   NM_079981.2  CG3650-RA (CG3650), mRNA, type II CG8856-RA (Sr-CII), mRNA 
0   NM_080329.2  CG3697-RA (mei-9), mRNA 
0   NM_143057.2  CG11771-RA (CG11771), mRNA 
0   NM_176385.1  CG33214-RA (CG33214), mRNA 
0   NM_139605.1  CG1299-RA (CG1299), mRNA 
0   NM_135389.1  CG13087-RA (CG13087), mRNA 
0   NM_170471.2  CG31030-RA, transcript variant A (CG31030), mRNA 
0   NM_001043310.1  CG31030-RB, transcript variant B (CG31030), mRNA 
0   NM_142343.2  CG17475-RA (CG17475), mRNA 
0   NM_079516.2  CG1433-RA (Atu), mRNA 
0   NM_057986.3  CG3456-RA (Mct1), mRNA 
0   NM_166540.1  CG30219-RA (CG30219), mRNA 
0   NM_164469.1  CG17239-RA (CG17239), mRNA 
0   NM_001032399.1  CG33955-RB (eys), mRNA 
0   NM_001038718.1  CG17469-RB, transcript variant B (Mitf), mRNA 
0   NM_001038719.1  CG17469-RA, transcript variant A (Mitf), mRNA 
0   NM_001015077.1  CG17469-PA.3 (CG17469), mRNA 
0   NM_135634.1  CG16840-RA (Art8), mRNA 
0   NM_079257.1  CG6533-RA (Cp16), mRNA 
0   NM_132885.2  CG3679-RA (CG3679), mRNA 
0   NM_142983.2  CG6356-RA (CG6356), mRNA 
0   NM_141910.1  CG3916-RA (CG3916), mRNA 
0   NM_141015.1  CG11037-RA (CG11037), mRNA 
0   NM_079400.2  CG7659-RA (tap), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_057962.4  CG1782-RA (Uba1), mRNA 
0   NM_139479.2  CG1246-RB (CG1246), mRNA 
0   NM_001031967.1  CG7749-RB, transcript variant B (fat2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.