National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7142R-2 
 Symbol CG7142  Full Name CG7142 
 CG No CG7142  Old CG No CG7142 
 Synonyms SP132, CG7142 
 Accession No (Link to NCBI) NM_142446.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACAATGGCCATGAATTTGGCGGCCTACGGGCTGCTGGAGAATCGGATTAGCACTCTGGAA 60

                          |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCACCGCGACAAACGCACTGGACGAAAAAGTTCCTGGCCAAGCGGGAGGCGACTCCCCAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     121 TCGGCGCCGTATGTGGTCAGCATCCAGATGATGACACCCGATCAGGGACTGGTCCACTAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     181 TGTGCCGGCACCATCATCAACGAGCACTGGATCCTGACGGCGGCCCACTGCCTC-AGCTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACCGCAGGCGGTGGAGAACTCGGTCATTGTGGCGGGCAGCCACGATATTCACGATCAGAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGGCGAGGCGAGCAACATTCAAATGCGACACATCGACTACTACGTGCGACACGAGCTCTA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCTCGGCGGAGTGAATCCCTACGACATCGCGCTAATTTACACCAAGGAGCCCCTGGTCTT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGACACCTATGTCCAGCCAGCAACGCTGCCGGAGCAGGATGCCCAGCCGGAGGGATATGG 480

7142R-2.IR_full       481 AACTTTGTACGGCTGGGGCAA 501
                          ||||||||||||||||||||| silico     481 AACTTTGTACGGCTGGGGCAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142446.2  CG7142-RA (CG7142), mRNA 
0.2   NM_138127.1  CG3650-RA (CG3650), mRNA 
0   NM_079981.2  CG3650-RA (CG3650), mRNA, type II CG8856-RA (Sr-CII), mRNA 
0   NM_080329.2  CG3697-RA (mei-9), mRNA 
0   NM_143057.2  CG11771-RA (CG11771), mRNA 
0   NM_176385.1  CG33214-RA (CG33214), mRNA 
0   NM_139605.1  CG1299-RA (CG1299), mRNA 
0   NM_135389.1  CG13087-RA (CG13087), mRNA 
0   NM_170471.2  CG31030-RA, transcript variant A (CG31030), mRNA 
0   NM_001043310.1  CG31030-RB, transcript variant B (CG31030), mRNA 
0   NM_142343.2  CG17475-RA (CG17475), mRNA 
0   NM_079516.2  CG1433-RA (Atu), mRNA 
0   NM_057986.3  CG3456-RA (Mct1), mRNA 
0   NM_166540.1  CG30219-RA (CG30219), mRNA 
0   NM_164469.1  CG17239-RA (CG17239), mRNA 
0   NM_001032399.1  CG33955-RB (eys), mRNA 
0   NM_001038718.1  CG17469-RB, transcript variant B (Mitf), mRNA 
0   NM_001038719.1  CG17469-RA, transcript variant A (Mitf), mRNA 
0   NM_001015077.1  CG17469-PA.3 (CG17469), mRNA 
0   NM_135634.1  CG16840-RA (Art8), mRNA 
0   NM_079257.1  CG6533-RA (Cp16), mRNA 
0   NM_132885.2  CG3679-RA (CG3679), mRNA 
0   NM_142983.2  CG6356-RA (CG6356), mRNA 
0   NM_141910.1  CG3916-RA (CG3916), mRNA 
0   NM_141015.1  CG11037-RA (CG11037), mRNA 
0   NM_079400.2  CG7659-RA (tap), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_057962.4  CG1782-RA (Uba1), mRNA 
0   NM_139479.2  CG1246-RB (CG1246), mRNA 
0   NM_001031967.1  CG7749-RB, transcript variant B (fat2), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.