National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7129R-8 
 Symbol l(3)05822  Full Name lethal (3) 05822 
 CG No CG7129  Old CG No CG7129 
 Synonyms CG7129, l(3)5822, clot 3142, LD12970, 5822, l(3)05822 
 Accession No (Link to NCBI) NM_143794.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGCAAATGCCAGCCTGGAAC 
 Primer Seq. 3'
aatctagaggtaccGCCGTAGACACGATTTTCCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGGCAAATGC CAGCCTGGAA CAGCTGCGTC TCCAGCTGCA GCAGCaNCAC CTGCAGCAAC 
0061 AGCAAGGCGC CGGCGGTGGA CTCCAAAAGC TGACCATCAA GCTGCCGCCA CCGCCCAAGG 
0121 GACCGCTGCA GTCGCAGCAC AAACGTACCA CCGTCAGCAA CAATAACAAC GGCAGCCTCT 
0181 TCGACGAGCC AACGGGTGGC ACGAGCATTA CGCGGNAAGT TTCCACNAGG CACGCTACAC 
0241 GCCGGCCACC AACTGGGACG ACGATCCATT TGGAGGCGGG AGCAACGGAA ATGATCGCTT 
0301 CAAGAAGATG CCACCGCCGC GACCGCCGCC GCCCAAGGTG CTGGTCAATG GGCAGAACAT 
0361 GACCAAGTCC AACTCCTCGA TGGCATCGGC GGTCACTGGC GGCACGGGCA GACTCATGTC 
0421 GAACATTTTC CATCGCAAGA AGTCGACGTC CACGGCATCC GCCGCTGCTT CCAAGGCTGC 
0481 AGCGGAAAAT CGTGTCTACG GC 
 in silico PCR Fragment
0001 GGGCAAATGC CAGCCTGGAA CAGCTGCGTC TCCAGCTGCA GCAGCAGCAC CTGCAGCAAC 
0061 AGCAAGGCGC CGGCGGTGGA CTCCAAAAGC TGACCATCAA GCTGCCGCCA CCGCCCAAGG 
0121 GACCGCTGCA GTCGCAGCAC AAACGTACCA CCGTCAGCAA CAATAACAAC GGCAGCCTCT 
0181 TCGACGAGCC AACGGGTGGC ACGAGCATTA CGCGG-AAGT TTCCAC-AGG CACGCTACAC 
0241 GCCGGCCACC AACTGGGACG ACGATCCATT TGGAGGCGGG AGCAACGGAA ATGATCGCTT 
0301 CAAGAAGATG CCACCGCCGC GACCGCCGCC GCCCAAGGTG CTGGTCAATG GGCAGAACAT 
0361 GACCAAGTCC AACTCCTCGA TGGCATCGGC GGTCACTGGC GGCACGGGCA GACTCATGTC 
0421 GAACATTTTC CATCGCAAGA AGTCGACGTC CACGGCATCC GCCGCTGCTT CCAAGGCTGC 
0481 AGCGGAAAAT CGTGTCTACG GC 
 Assemble Data

7129R-8.IR_full       1   GGGCAAATGCCAGCCTGGAACAGCTGCGTCTCCAGCTGCAGCAGCANCACCTGCAGCAAC 60
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7129R-8.in silico     1   GGGCAAATGCCAGCCTGGAACAGCTGCGTCTCCAGCTGCAGCAGCAGCACCTGCAGCAAC 60


7129R-8.IR_full       61  AGCAAGGCGCCGGCGGTGGACTCCAAAAGCTGACCATCAAGCTGCCGCCACCGCCCAAGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7129R-8.in silico     61  AGCAAGGCGCCGGCGGTGGACTCCAAAAGCTGACCATCAAGCTGCCGCCACCGCCCAAGG 120


7129R-8.IR_full       121 GACCGCTGCAGTCGCAGCACAAACGTACCACCGTCAGCAACAATAACAACGGCAGCCTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7129R-8.in silico     121 GACCGCTGCAGTCGCAGCACAAACGTACCACCGTCAGCAACAATAACAACGGCAGCCTCT 180


7129R-8.IR_full       181 TCGACGAGCCAACGGGTGGCACGAGCATTACGCGGNAAGTTTCCACNAGGCACGCTACAC 240
                          ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||
7129R-8.in silico     181 TCGACGAGCCAACGGGTGGCACGAGCATTACGCGG-AAGTTTCCAC-AGGCACGCTACAC 240


7129R-8.IR_full       241 GCCGGCCACCAACTGGGACGACGATCCATTTGGAGGCGGGAGCAACGGAAATGATCGCTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7129R-8.in silico     241 GCCGGCCACCAACTGGGACGACGATCCATTTGGAGGCGGGAGCAACGGAAATGATCGCTT 300


7129R-8.IR_full       301 CAAGAAGATGCCACCGCCGCGACCGCCGCCGCCCAAGGTGCTGGTCAATGGGCAGAACAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7129R-8.in silico     301 CAAGAAGATGCCACCGCCGCGACCGCCGCCGCCCAAGGTGCTGGTCAATGGGCAGAACAT 360


7129R-8.IR_full       361 GACCAAGTCCAACTCCTCGATGGCATCGGCGGTCACTGGCGGCACGGGCAGACTCATGTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7129R-8.in silico     361 GACCAAGTCCAACTCCTCGATGGCATCGGCGGTCACTGGCGGCACGGGCAGACTCATGTC 420


7129R-8.IR_full       421 GAACATTTTCCATCGCAAGAAGTCGACGTCCACGGCATCCGCCGCTGCTTCCAAGGCTGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7129R-8.in silico     421 GAACATTTTCCATCGCAAGAAGTCGACGTCCACGGCATCCGCCGCTGCTTCCAAGGCTGC 480


7129R-8.IR_full       481 AGCGGAAAATCGTGTCTACGGC 502
                          ||||||||||||||||||||||
7129R-8.in silico     481 AGCGGAAAATCGTGTCTACGGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  15  NM_143794.2  CG7129-RA, transcript variant A (l(3)05822), mRNA 
100   482  12  NM_169802.1  CG7129-RB, transcript variant B (l(3)05822), mRNA 
0.82   11  10  56  NM_079714.2  CG6706-RB, transcript variant B (GABA-B-R2), mRNA 
0.82   11  10  56  NM_169968.1  CG6706-RA, transcript variant A (GABA-B-R2), mRNA 
0.41   36  141  NM_001014590.1  CG32180-RD, transcript variant D (Eip74EF), mRNA 
0.41   36  141  NM_168741.2  CG32180-RB, transcript variant B (Eip74EF), mRNA 
0.41   34  133  NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0.41   34  133  NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0.41   11  33  NM_080337.2  CG6899-RA, transcript variant A (Ptp4E), mRNA 
0.41   20  NM_078573.2  CG1822-RC, transcript variant C (bif), mRNA 
0.41   20  NM_167295.1  CG1822-RB, transcript variant B (bif), mRNA 
0.2   56  171  NM_134527.1  CG15322-RA (CG15322), mRNA 
0.2   NM_135021.2  CG12194-RA (CG12194), mRNA 
0.2   11  NM_058067.2  CG6147-RA (Tsc1), mRNA 
0.2   13  NM_057606.4  CG1759-RA, transcript variant A (cad), mRNA 
0.2   13  NM_134301.3  CG1759-RB, transcript variant B (cad), mRNA 
0.2   NM_165177.1  CG17332-RB, transcript variant B (VhaSFD), mRNA 
0   13  91  NM_001043298.1  CG33553-RH, transcript variant H (Doa), mRNA 
0   13  91  NM_001014681.1  CG33553-RD, transcript variant D (Doa), mRNA 
0   13  90  NM_001014679.1  CG33553-RC, transcript variant C (Doa), mRNA 
0   37  156  NM_141639.1  CG16779-RA (CG16779), mRNA 
0   31  82  NM_142259.2  CG10278-RA (GATAe), mRNA 
0   60  200  NM_137212.2  CG30089-RA (CG30089), mRNA 
0   22  58  NM_001032071.1  CG6713-RD, transcript variant D (Nos), mRNA 
0   22  58  NM_078817.3  CG6713-RA, transcript variant A (Nos), mRNA 
0   22  58  NM_001032073.1  CG6713-RB, transcript variant B (Nos), mRNA 
0   22  58  NM_001032072.1  CG6713-RC, transcript variant C (Nos), mRNA 
0   22  58  NM_001032070.1  CG6713-RE, transcript variant E (Nos), mRNA 
0   22  58  NM_001032067.1  CG6713-RH, transcript variant H (Nos), mRNA 
0   22  58  NM_001032075.1  CG6713-RI, transcript variant I (Nos), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.