National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7129R-6 
 Symbol l(3)05822  Full Name lethal (3) 05822 
 CG No CG7129  Old CG No CG7129 
 Synonyms CG7129, l(3)5822, clot 3142, LD12970, 5822, l(3)05822 
 Accession No (Link to NCBI) NM_143794.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     1   GGGCAAATGCCAGCCTGGAACAGCTGCGTCTCCAGCTGCAGCAGCAGCACCTGCAGCAAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGCAAGGCGCCGGCGGTGGACTCCAAAAGCTGACCATCAAGCTGCCGCCACCGCCCAAGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GACCGCTGCAGTCGCAGCACAAACGTACCACCGTCAGCAACAATAACAACGGCAGCCTCT 180

                          ||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| silico     181 TCGACGAGCCAACGGGTGGCACGAGCATTACGCGG-AAGTTTCCAC-AGGCACGCTACAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCCGGCCACCAACTGGGACGACGATCCATTTGGAGGCGGGAGCAACGGAAATGATCGCTT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAAGAAGATGCCACCGCCGCGACCGCCGCCGCCCAAGGTGCTGGTCAATGGGCAGAACAT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACCAAGTCCAACTCCTCGATGGCATCGGCGGTCACTGGCGGCACGGGCAGACTCATGTC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAACATTTTCCATCGCAAGAAGTCGACGTCCACGGCATCCGCCGCTGCTTCCAAGGCTGC 480

7129R-6.IR_full       481 AGCGGAAAATCGTGTCTACGGC 502
                          |||||||||||||||||||||| silico     481 AGCGGAAAATCGTGTCTACGGC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  15  NM_143794.2  CG7129-RA, transcript variant A (l(3)05822), mRNA 
100   482  12  NM_169802.1  CG7129-RB, transcript variant B (l(3)05822), mRNA 
0.82   11  10  56  NM_079714.2  CG6706-RB, transcript variant B (GABA-B-R2), mRNA 
0.82   11  10  56  NM_169968.1  CG6706-RA, transcript variant A (GABA-B-R2), mRNA 
0.41   36  141  NM_001014590.1  CG32180-RD, transcript variant D (Eip74EF), mRNA 
0.41   36  141  NM_168741.2  CG32180-RB, transcript variant B (Eip74EF), mRNA 
0.41   34  133  NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0.41   34  133  NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0.41   11  33  NM_080337.2  CG6899-RA, transcript variant A (Ptp4E), mRNA 
0.41   20  NM_078573.2  CG1822-RC, transcript variant C (bif), mRNA 
0.41   20  NM_167295.1  CG1822-RB, transcript variant B (bif), mRNA 
0.2   56  171  NM_134527.1  CG15322-RA (CG15322), mRNA 
0.2   NM_135021.2  CG12194-RA (CG12194), mRNA 
0.2   11  NM_058067.2  CG6147-RA (Tsc1), mRNA 
0.2   13  NM_057606.4  CG1759-RA, transcript variant A (cad), mRNA 
0.2   13  NM_134301.3  CG1759-RB, transcript variant B (cad), mRNA 
0.2   NM_165177.1  CG17332-RB, transcript variant B (VhaSFD), mRNA 
0   13  91  NM_001043298.1  CG33553-RH, transcript variant H (Doa), mRNA 
0   13  91  NM_001014681.1  CG33553-RD, transcript variant D (Doa), mRNA 
0   13  90  NM_001014679.1  CG33553-RC, transcript variant C (Doa), mRNA 
0   37  156  NM_141639.1  CG16779-RA (CG16779), mRNA 
0   31  82  NM_142259.2  CG10278-RA (GATAe), mRNA 
0   60  200  NM_137212.2  CG30089-RA (CG30089), mRNA 
0   22  58  NM_001032071.1  CG6713-RD, transcript variant D (Nos), mRNA 
0   22  58  NM_078817.3  CG6713-RA, transcript variant A (Nos), mRNA 
0   22  58  NM_001032073.1  CG6713-RB, transcript variant B (Nos), mRNA 
0   22  58  NM_001032072.1  CG6713-RC, transcript variant C (Nos), mRNA 
0   22  58  NM_001032070.1  CG6713-RE, transcript variant E (Nos), mRNA 
0   22  58  NM_001032067.1  CG6713-RH, transcript variant H (Nos), mRNA 
0   22  58  NM_001032075.1  CG6713-RI, transcript variant I (Nos), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.