National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7066R-1 
 Symbol CG7066  Full Name CG7066 
 CG No CG7066  Old CG No CG7066 
 Synonyms CG7066 
 Accession No (Link to NCBI) NM_139947.2 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATAAGGAGGAGCAGGAATCAG 
 Primer Seq. 3'
aatctagaggtaccGGTGCAGTTGTCACAATAGCT 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 ATAAGGAGGA GCAGGAATCA GGATGTCCAG GATACAGCGA TCAAGATTAC TCCACGCAgc 
0061 TCCAAGTACA AAAACCAGCA CAGGAAACGG GAGCAGCAAA CCTCTCTTCT GGACTTTGTC 
0121 ATCAAGCCGA GACCAAAAAC ACAAAGGCAA ACAAAGGCAC ATAAACTTCA AAAGACACAT 
0181 TTAGCCATAA CAAGAGGTAG CTACATAGTT TACAAACCCA AGGGCAAAAC CCGCCTTGAT 
0241 CCCAAGAAGA AGATCACCAG GTTGAAGAAG TCCGTACGTG TATATCGCAC TTCAAAGAAG 
0301 GCGGAGAGAG AAGTCGCAGA GAATGATCTT GAAGGAGTCC CAGTAGTTGG TCAAGATATC 
0361 AATCCGAATG CTATTCCGCT GGAGCAACAA GTTCAAAACC TATCACTTAG TAAAACCCCT 
0421 GCACCCAACA ACCCTTCACA AGCAAAAACA GTACATGCCA TTCACTCACG GCGATTTAGA 
0481 AGCTATTGTG ACAACTGCAC C 
 in silico PCR Fragment
0001 ATAAGGAGGA GCAGGAATCA GGATGTCCAG GATACAGCGA TCAAGATTAC TCCACGCAGC 
0061 TCCAAGTACA AAAACCAGCA CAGGAAACGG GAGCAGCAAA CCTCTCTTCT GGACTTTGTC 
0121 ATCAAGCCGA GACCAAAAAC ACAAAGGCAA ACAAAGGCAC ATAAACTTCA AAAGACACAT 
0181 TTAGCCATAA CAAGAGGTAG CTACATAGTT TACAAACCCA AGGGCAAAAC CCGCCTTGAT 
0241 CCCAAGAAGA AGATCACCAG GTTGAAGAAG TCCGTACGTG TATATCGCAC TTCAAAGAAG 
0301 GCGGAGAGAG AAGTCGCAGA GAATGATCTT GAAGGAGTCC CAGTAGTTGG TCAAGATATC 
0361 AATCCGAATG CTATTCCGCT GGAGCAACAA GTTCAAAACC TATCACTTAG TAAAACCCCT 
0421 GCACCCAACA ACCCTTCACA AGCAAAAACA GTACATGCCA TTCACTCACG GCGATTTAGA 
0481 AGCTATTGTG ACAACTGCAC C 
 Assemble Data

7066R-1.IR_full       1   ATAAGGAGGAGCAGGAATCAGGATGTCCAGGATACAGCGATCAAGATTACTCCACGCAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7066R-1.in silico     1   ATAAGGAGGAGCAGGAATCAGGATGTCCAGGATACAGCGATCAAGATTACTCCACGCAGC 60


7066R-1.IR_full       61  TCCAAGTACAAAAACCAGCACAGGAAACGGGAGCAGCAAACCTCTCTTCTGGACTTTGTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7066R-1.in silico     61  TCCAAGTACAAAAACCAGCACAGGAAACGGGAGCAGCAAACCTCTCTTCTGGACTTTGTC 120


7066R-1.IR_full       121 ATCAAGCCGAGACCAAAAACACAAAGGCAAACAAAGGCACATAAACTTCAAAAGACACAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7066R-1.in silico     121 ATCAAGCCGAGACCAAAAACACAAAGGCAAACAAAGGCACATAAACTTCAAAAGACACAT 180


7066R-1.IR_full       181 TTAGCCATAACAAGAGGTAGCTACATAGTTTACAAACCCAAGGGCAAAACCCGCCTTGAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7066R-1.in silico     181 TTAGCCATAACAAGAGGTAGCTACATAGTTTACAAACCCAAGGGCAAAACCCGCCTTGAT 240


7066R-1.IR_full       241 CCCAAGAAGAAGATCACCAGGTTGAAGAAGTCCGTACGTGTATATCGCACTTCAAAGAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7066R-1.in silico     241 CCCAAGAAGAAGATCACCAGGTTGAAGAAGTCCGTACGTGTATATCGCACTTCAAAGAAG 300


7066R-1.IR_full       301 GCGGAGAGAGAAGTCGCAGAGAATGATCTTGAAGGAGTCCCAGTAGTTGGTCAAGATATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7066R-1.in silico     301 GCGGAGAGAGAAGTCGCAGAGAATGATCTTGAAGGAGTCCCAGTAGTTGGTCAAGATATC 360


7066R-1.IR_full       361 AATCCGAATGCTATTCCGCTGGAGCAACAAGTTCAAAACCTATCACTTAGTAAAACCCCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7066R-1.in silico     361 AATCCGAATGCTATTCCGCTGGAGCAACAAGTTCAAAACCTATCACTTAGTAAAACCCCT 420


7066R-1.IR_full       421 GCACCCAACAACCCTTCACAAGCAAAAACAGTACATGCCATTCACTCACGGCGATTTAGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7066R-1.in silico     421 GCACCCAACAACCCTTCACAAGCAAAAACAGTACATGCCATTCACTCACGGCGATTTAGA 480


7066R-1.IR_full       481 AGCTATTGTGACAACTGCACC 501
                          |||||||||||||||||||||
7066R-1.in silico     481 AGCTATTGTGACAACTGCACC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_139947.2  CG7066-RA (CG7066), mRNA 
0   NM_170256.1  CG8384-RC, transcript variant C (gro), mRNA 
0   NM_165738.1  CG2269-RC, transcript variant C (CG2269), mRNA 
0   NM_136709.2  CG2269-RA, transcript variant A (CG2269), mRNA 
0   NM_165737.1  CG2269-RB, transcript variant B (CG2269), mRNA 
0   NM_166516.1  CG11170-RB (CG11170), mRNA 
0   NM_165879.1  CG8841-RB, transcript variant B (CG8841), mRNA 
0   NM_136916.2  CG8841-RA, transcript variant A (CG8841), mRNA 
0   NM_165880.1  CG8841-RC, transcript variant C (CG8841), mRNA 
0   NM_142221.1  CG18516-RA (CG18516), mRNA 
0   NM_001014613.2  CG17117-RE, transcript variant E (hth), mRNA 
0   NM_136055.2  CG10376-RA (CG10376), mRNA 
0   NM_167969.1  CG32488-RA (CG32488), mRNA 
0   NM_143677.2  CG11360-RA (CG11360), mRNA 
0   NM_140296.2  CG5642-RA (CG5642), mRNA 
0   NM_136705.1  CG2292-RA (CG2292), mRNA 
0   NM_140927.2  CG6981-RA, transcript variant A (CG6981), mRNA 
0   NM_168831.1  CG6981-RB, transcript variant B (CG6981), mRNA 
0   NM_143761.2  CG10241-RA (Cyp6a17), mRNA 
0   NM_078747.2  CG2969-RA, transcript variant A (Atet), mRNA 
0   NM_164580.1  CG2969-RB, transcript variant B (Atet), mRNA 
0   NM_079460.2  CG18803-RA, transcript variant A (Psn), mRNA 
0   NM_168856.1  CG18803-RB, transcript variant B (Psn), mRNA 
0   NM_140436.1  CG8100-RA (CG8100), mRNA 
0   NM_130594.1  CG14803-RA (CG14803), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_166063.1  CG10145-RA (mspo), mRNA 
0   NM_079408.4  CG5492-RB, transcript variant B (Tsp74F), mRNA 
0   NM_168754.1  CG5492-RA, transcript variant A (Tsp74F), mRNA 
0   NM_142894.1  CG10175-RC, transcript variant C (CG10175), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.