National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7037R-2 
 Symbol Cbl  Full Name Cbl 
 CG No CG7037  Old CG No CG7037 
 Synonyms CBL, d-cbl, D-cbl, D-Cbl, D-cblL, CG7037, DCbl, cbl, Dv-Cbl, dCbl, Dv-cbl, unnamed, Dcbl, F165, CG7043, anon-WO0118547.68, Cbl, D-cblS, D-Cbl L 
 Accession No (Link to NCBI) NM_168276.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   ACAAGAAGACGCTGGAGAAGACCTGGAAGTTGATGGACAAGGTGGTCAAACTGTGCCAG 59

                          ||||||||    |||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGCCGAA----GATGAATCTTAAGAATAGTCCACCGTTTATTTTGGACATCCTGCCGGA 119

                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     121 TACGTACCAGCGCCT-GAGATTGATCTACTCAAAGAACGAGGACCAGATGCACCTGCTCC 179

                          |||||||||||||||||||  |||||||||||||||||||||||||||||| |||||||| silico     181 ATGCCAACGAGCACTTCAA--CGTGTTCATCAACAACCTGATGCGAAAGTG-CAAGCAGG 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCATCAAGTTGTTCAAGGAGGGCAAGGAGAAGATGTTCGACGAGAACTCCCACTACCGCC 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCAATCTCACCAAGCTCAGCCTGGTCTTCTCCCACATGCTCAGCGAACTGAAGGCCATAT 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCCCCAACGGTGTCTTTGCCGGGGATCAATTTCGGATCACCAAAGCGGATGCGGCTGACT 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTTGGAAGAGCAACTTCGGTAACAGCACATTGGTTCCCTGGAAAATCTTCCGGCAGGAGC 479

                          |||||||||||||||||||||||||||| silico     481 TTAACAAAGTACATCCCATAATCTCCGG 507

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139967.1  CG7037-RB, transcript variant B (Cbl), mRNA 
100   482  NM_168276.1  CG7037-RA, transcript variant A (Cbl), mRNA 
0.41   NM_139503.1  CG2162-RA (CG2162), mRNA 
0   NM_079770.2  CG7748-RA (OstStt3), mRNA 
0   NM_140953.2  CG5605-RA, transcript variant A (eRF1), mRNA 
0   NM_168848.1  CG5605-RF, transcript variant F (eRF1), mRNA 
0   NM_176369.1  CG5605-RG, transcript variant G (eRF1), mRNA 
0   NM_168847.1  CG5605-RE, transcript variant E (eRF1), mRNA 
0   NM_168845.1  CG5605-RB, transcript variant B (eRF1), mRNA 
0   NM_168846.1  CG5605-RC, transcript variant C (eRF1), mRNA 
0   NM_139424.1  CG11814-RA (CG11814), mRNA 
0   NM_169574.1  CG8573-RB, transcript variant B (su(Hw)), mRNA 
0   NM_079625.2  CG8573-RA, transcript variant A (su(Hw)), mRNA 
0   NM_001014749.1  CG8527-RB, transcript variant B (ppk23), mRNA 
0   NM_132992.2  CG8527-RA, transcript variant A (ppk23), mRNA 
0   NM_079121.2  CG3416-RA (Mov34), mRNA 
0   NM_001042957.1  CG18140-RA (Cht3), mRNA 
0   11  NM_001043247.1  CG6535-RB (tefu), mRNA 
0   NM_057362.2  CG17579-RA, transcript variant A (sca), mRNA 
0   NM_165951.1  CG17579-RB, transcript variant B (sca), mRNA 
0   NM_057790.4  CG32848-RA (VAChT), mRNA 
0   NM_132032.1  CG15769-RA (CG15769), mRNA 
0   NM_079085.3  CG3613-RA (qkr58E-1), mRNA 
0   NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0   NM_001043308.1  CG34133-RB, transcript variant B (CG34133), mRNA 
0   NR_002106.1  CR32661, miscRNA 
0   NM_001043307.1  CG34133-RA, transcript variant A (CG34133), mRNA 
0   NM_141755.2  CG14691-RA, transcript variant A (CG14691), mRNA 
0   NM_079026.2  CG8095-RB, transcript variant B (scb), mRNA 
0   NM_166083.1  CG8095-RA, transcript variant A (scb), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.