National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7037R-1 
 Symbol Cbl  Full Name Cbl 
 CG No CG7037  Old CG No CG7037 
 Synonyms CBL, d-cbl, D-cbl, D-Cbl, D-cblL, CG7037, DCbl, cbl, Dv-Cbl, dCbl, Dv-cbl, unnamed, Dcbl, F165, CG7043, anon-WO0118547.68, Cbl, D-cblS, D-Cbl L 
 Accession No (Link to NCBI) NM_168276.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACAAGAAGACGCTGGAGAAG 
 Primer Seq. 3'
aatctagaggtaccCCGGAGATTATGGGATGTACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NACAAGAAGA CGCTGGAGAA GACCTGGAAG TTGATGGACA AGGTGGTCAA ACTGTGCCAG 
0061 CAGCCGAATC NCGATGAATC TTAAGAATAG TCCACCGTTT ATTTTGGACA TCCTGCCGGA 
0121 TACGTACCAG CGCCTAGAGA TTGATCTACT CAAAGAACGA GGACCAGATG CACCTGCTCC 
0181 ATGCCAACGA GCACTTCAAC TCGTGTTCAT CAACAACCTG ATGCGAAAGT GTCAAGCAGG 
0241 CCATCAAGTT GTTCAAGGAG GGCAAGGAGA AGATGTTCGA CGAGAACTCC CACTACCGCC 
0301 GCAATCTCAC CAAGCTCAGC CTGGTCTTCT CCCACATGCT CAGCGAACTG AAGGCCATAT 
0361 TCCCCAACGG TGTCTTTGCC GGGGATCAAT TTCGGATCAC CAAAGCGGAT GCGGCTGACT 
0421 TTTGGAAGAG CAACTTCGGT AACAGCACAT TGGTTCCCTG GAAAATCTTC CGGCAGGAGC 
0481 TTAACAAAGT ACATCCCATA ATCTCCGG 
 in silico PCR Fragment
0001 GACAAGAAGA CGCTGGAGAA GACCTGGAAG TTGATGGACA AGGTGGTCAA ACTGTGCCAG 
0061 CAGCCGAA-- --GATGAATC TTAAGAATAG TCCACCGTTT ATTTTGGACA TCCTGCCGGA 
0121 TACGTACCAG CGCCT-GAGA TTGATCTACT CAAAGAACGA GGACCAGATG CACCTGCTCC 
0181 ATGCCAACGA GCACTTCAA- -CGTGTTCAT CAACAACCTG ATGCGAAAGT G-CAAGCAGG 
0241 CCATCAAGTT GTTCAAGGAG GGCAAGGAGA AGATGTTCGA CGAGAACTCC CACTACCGCC 
0301 GCAATCTCAC CAAGCTCAGC CTGGTCTTCT CCCACATGCT CAGCGAACTG AAGGCCATAT 
0361 TCCCCAACGG TGTCTTTGCC GGGGATCAAT TTCGGATCAC CAAAGCGGAT GCGGCTGACT 
0421 TTTGGAAGAG CAACTTCGGT AACAGCACAT TGGTTCCCTG GAAAATCTTC CGGCAGGAGC 
0481 TTAACAAAGT ACATCCCATA ATCTCCGG 
 Assemble Data

7037R-1.IR_full        1   ACAAGAAGACGCTGGAGAAGACCTGGAAGTTGATGGACAAGGTGGTCAAACTGTGCCAG 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7037R-1.in silico      1   ACAAGAAGACGCTGGAGAAGACCTGGAAGTTGATGGACAAGGTGGTCAAACTGTGCCAG 59


7037R-1.IR_full       61  CAGCCGAATCNCGATGAATCTTAAGAATAGTCCACCGTTTATTTTGGACATCCTGCCGGA 119
                          ||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||
7037R-1.in silico     61  CAGCCGAA----GATGAATCTTAAGAATAGTCCACCGTTTATTTTGGACATCCTGCCGGA 119


7037R-1.IR_full       121 TACGTACCAGCGCCTAGAGATTGATCTACTCAAAGAACGAGGACCAGATGCACCTGCTCC 179
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
7037R-1.in silico     121 TACGTACCAGCGCCT-GAGATTGATCTACTCAAAGAACGAGGACCAGATGCACCTGCTCC 179


7037R-1.IR_full       181 ATGCCAACGAGCACTTCAACTCGTGTTCATCAACAACCTGATGCGAAAGTGTCAAGCAGG 239
                          |||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||
7037R-1.in silico     181 ATGCCAACGAGCACTTCAA--CGTGTTCATCAACAACCTGATGCGAAAGTG-CAAGCAGG 239


7037R-1.IR_full       241 CCATCAAGTTGTTCAAGGAGGGCAAGGAGAAGATGTTCGACGAGAACTCCCACTACCGCC 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7037R-1.in silico     241 CCATCAAGTTGTTCAAGGAGGGCAAGGAGAAGATGTTCGACGAGAACTCCCACTACCGCC 299


7037R-1.IR_full       301 GCAATCTCACCAAGCTCAGCCTGGTCTTCTCCCACATGCTCAGCGAACTGAAGGCCATAT 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7037R-1.in silico     301 GCAATCTCACCAAGCTCAGCCTGGTCTTCTCCCACATGCTCAGCGAACTGAAGGCCATAT 359


7037R-1.IR_full       361 TCCCCAACGGTGTCTTTGCCGGGGATCAATTTCGGATCACCAAAGCGGATGCGGCTGACT 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7037R-1.in silico     361 TCCCCAACGGTGTCTTTGCCGGGGATCAATTTCGGATCACCAAAGCGGATGCGGCTGACT 419


7037R-1.IR_full       421 TTTGGAAGAGCAACTTCGGTAACAGCACATTGGTTCCCTGGAAAATCTTCCGGCAGGAGC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7037R-1.in silico     421 TTTGGAAGAGCAACTTCGGTAACAGCACATTGGTTCCCTGGAAAATCTTCCGGCAGGAGC 479


7037R-1.IR_full       481 TTAACAAAGTACATCCCATAATCTCCGG 507
                          ||||||||||||||||||||||||||||
7037R-1.in silico     481 TTAACAAAGTACATCCCATAATCTCCGG 507

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139967.1  CG7037-RB, transcript variant B (Cbl), mRNA 
100   482  NM_168276.1  CG7037-RA, transcript variant A (Cbl), mRNA 
0.41   NM_139503.1  CG2162-RA (CG2162), mRNA 
0   NM_079770.2  CG7748-RA (OstStt3), mRNA 
0   NM_140953.2  CG5605-RA, transcript variant A (eRF1), mRNA 
0   NM_168848.1  CG5605-RF, transcript variant F (eRF1), mRNA 
0   NM_176369.1  CG5605-RG, transcript variant G (eRF1), mRNA 
0   NM_168847.1  CG5605-RE, transcript variant E (eRF1), mRNA 
0   NM_168845.1  CG5605-RB, transcript variant B (eRF1), mRNA 
0   NM_168846.1  CG5605-RC, transcript variant C (eRF1), mRNA 
0   NM_139424.1  CG11814-RA (CG11814), mRNA 
0   NM_169574.1  CG8573-RB, transcript variant B (su(Hw)), mRNA 
0   NM_079625.2  CG8573-RA, transcript variant A (su(Hw)), mRNA 
0   NM_001014749.1  CG8527-RB, transcript variant B (ppk23), mRNA 
0   NM_132992.2  CG8527-RA, transcript variant A (ppk23), mRNA 
0   NM_079121.2  CG3416-RA (Mov34), mRNA 
0   NM_001042957.1  CG18140-RA (Cht3), mRNA 
0   11  NM_001043247.1  CG6535-RB (tefu), mRNA 
0   NM_057362.2  CG17579-RA, transcript variant A (sca), mRNA 
0   NM_165951.1  CG17579-RB, transcript variant B (sca), mRNA 
0   NM_057790.4  CG32848-RA (VAChT), mRNA 
0   NM_132032.1  CG15769-RA (CG15769), mRNA 
0   NM_079085.3  CG3613-RA (qkr58E-1), mRNA 
0   NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0   NM_001043308.1  CG34133-RB, transcript variant B (CG34133), mRNA 
0   NR_002106.1  CR32661, miscRNA 
0   NM_001043307.1  CG34133-RA, transcript variant A (CG34133), mRNA 
0   NM_141755.2  CG14691-RA, transcript variant A (CG14691), mRNA 
0   NM_079026.2  CG8095-RB, transcript variant B (scb), mRNA 
0   NM_166083.1  CG8095-RA, transcript variant A (scb), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.