National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7017R-1 
 Symbol CG7017  Full Name CG7017 
 CG No CG7017  Old CG No CG7017 
 Synonyms CG7017 
 Accession No (Link to NCBI) NM_140933.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCTGCTGCCGCAGGAGACAA 
 Primer Seq. 3'
aatctagaggtaccACAGGCTCGGCTGTGCAAGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCTGNATCT GCCGCAGGAG ACAAGCTTCC TGCGACCGAA TACCTGCGAC AACTGGGTGC 
0061 GGTGCGCCAG CAACTACAGC GTGCTGGAGC AGGGCGGCTG TGCCGCAGGA CTTCAACTAC 
0121 AACAAGGAGC TANGGCCGCT GCATCCTGGC ATCCTCCAGC GCCGCGGTGT GTCCCTATGC 
0181 CGACAGCATT GCGGACAAGG CCACGAACCT GTGCGCCAAC GAAACGGAAG GCGCCTTCAT 
0241 CGTGGATCCC AGCAGCAGCG ATNTGTCGCG GCTACATCTT GTGCAAGTCG CACAAGCAGA 
0301 TCAAGGCCAA CTGTCCCAAC GAGCTGATCT TCCATCCCGT ATCGAGGTCT TGCGTGTACG 
0361 AAAAGCAGTA CCGTTGCCCC ATCAGCCAGA CGAAGAAGAC CAGTCCCGCC TGCCGATCCC 
0421 TGCCGAACAA CACCCGTCTG GCCGATCCCG TCCACTGTGA CCAGTACTAC GAGTGCGTCA 
0481 GCGAGGTCTT GcACANCCGA GCCTGT 
 in silico PCR Fragment
0001 ACCTG---CT GCCGCAGGAG ACAAGCTTCC TGCGACCGAA TACCTGCGAC AACTGGGTGC 
0061 GGTGCGCCAG CAACTACAGC GTGCTGGAGC AGGGCGGCTG TGCCGCAGGA C-TCAACTAC 
0121 AACAAGGAGC TA-GGCCGCT GCATCCTGGC ATCCTCCAGC GCCGCGGTGT GTCCCTATGC 
0181 CGACAGCATT GCGGACAAGG CCACGAACCT GTGCGCCAAC GAAACGGAAG GCGCCTTCAT 
0241 CGTGGATCCC AGCAGCAGCG AT-TGTCGCG GCTACATCTT GTGCAAGTCG CACAAGCAGA 
0301 TCAAGGCCAA CTGTCCCAAC GAGCTGATCT TCCATCCCGT ATCGAGGTCT TGCGTGTACG 
0361 AAAAGCAGTA CCGTTGCCCC ATCAGCCAGA CGAAGAAGAC CAGTCCCGCC TGCCGATCCC 
0421 TGCCGAACAA CACCCGTCTG GCCGATCCCG TCCACTGTGA CCAGTACTAC GAGTGCGTCA 
0481 GCGAGGTCTT GCACAGCCGA GCCTGT 
 Assemble Data

7017R-1.IR_full       1   ACCTGNATCTGCCGCAGGAGACAAGCTTCCTGCGACCGAATACCTGCGACAACTGGGTGC 60
                          |||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||
7017R-1.in silico     1   ACCTG---CTGCCGCAGGAGACAAGCTTCCTGCGACCGAATACCTGCGACAACTGGGTGC 60


7017R-1.IR_full       61  GGTGCGCCAGCAACTACAGCGTGCTGGAGCAGGGCGGCTGTGCCGCAGGACTTCAACTAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
7017R-1.in silico     61  GGTGCGCCAGCAACTACAGCGTGCTGGAGCAGGGCGGCTGTGCCGCAGGAC-TCAACTAC 120


7017R-1.IR_full       121 AACAAGGAGCTANGGCCGCTGCATCCTGGCATCCTCCAGCGCCGCGGTGTGTCCCTATGC 180
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
7017R-1.in silico     121 AACAAGGAGCTA-GGCCGCTGCATCCTGGCATCCTCCAGCGCCGCGGTGTGTCCCTATGC 180


7017R-1.IR_full       181 CGACAGCATTGCGGACAAGGCCACGAACCTGTGCGCCAACGAAACGGAAGGCGCCTTCAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7017R-1.in silico     181 CGACAGCATTGCGGACAAGGCCACGAACCTGTGCGCCAACGAAACGGAAGGCGCCTTCAT 240


7017R-1.IR_full       241 CGTGGATCCCAGCAGCAGCGATNTGTCGCGGCTACATCTTGTGCAAGTCGCACAAGCAGA 300
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
7017R-1.in silico     241 CGTGGATCCCAGCAGCAGCGAT-TGTCGCGGCTACATCTTGTGCAAGTCGCACAAGCAGA 300


7017R-1.IR_full       301 TCAAGGCCAACTGTCCCAACGAGCTGATCTTCCATCCCGTATCGAGGTCTTGCGTGTACG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7017R-1.in silico     301 TCAAGGCCAACTGTCCCAACGAGCTGATCTTCCATCCCGTATCGAGGTCTTGCGTGTACG 360


7017R-1.IR_full       361 AAAAGCAGTACCGTTGCCCCATCAGCCAGACGAAGAAGACCAGTCCCGCCTGCCGATCCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7017R-1.in silico     361 AAAAGCAGTACCGTTGCCCCATCAGCCAGACGAAGAAGACCAGTCCCGCCTGCCGATCCC 420


7017R-1.IR_full       421 TGCCGAACAACACCCGTCTGGCCGATCCCGTCCACTGTGACCAGTACTACGAGTGCGTCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7017R-1.in silico     421 TGCCGAACAACACCCGTCTGGCCGATCCCGTCCACTGTGACCAGTACTACGAGTGCGTCA 480


7017R-1.IR_full       481 GCGAGGTCTTGCACANCCGAGCCTGT 506
                          ||||||||||||||| ||||||||||
7017R-1.in silico     481 GCGAGGTCTTGCACAGCCGAGCCTGT 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140933.1  CG7017-RA (CG7017), mRNA 
0   NM_206430.1  CG2666-RC, transcript variant C (kkv), mRNA 
0   NM_079509.1  CG2666-RA, transcript variant A (kkv), mRNA 
0   NM_169052.1  CG2666-RB, transcript variant B (kkv), mRNA 
0   NM_001031865.1  CG33950-RB, transcript variant B (trol), mRNA 
0   NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_079857.3  CG1378-RA (tll), mRNA 
0   NM_167956.1  CG1044-RB, transcript variant B (dos), mRNA 
0   NM_130660.1  CG2650-RA (CG2650), mRNA 
0   NM_140575.2  CG5241-RA (CG5241), mRNA 
0   NM_136439.2  CG11127-RA (CG11127), mRNA 
0   NM_136462.1  CG30491-RA (CG30491), mRNA 
0   NM_135676.2  CG14940-RA (Pde1c), mRNA 
0   NM_165385.2  CG12548-RA, transcript variant A (nompB), mRNA 
0   NM_132091.2  CG3861-RA, transcript variant A (l(1)G0030), mRNA 
0   NM_167072.1  CG3861-RB, transcript variant B (l(1)G0030), mRNA 
0   NM_165216.1  CG6794-RB, transcript variant B (Dif), mRNA 
0   NM_078865.2  CG6794-RA, transcript variant A (Dif), mRNA 
0   NM_078889.3  CG12548-RB, transcript variant B (nompB), mRNA 
0   NM_140881.2  CG8786-RB (CG8786), mRNA 
0   NM_169763.1  CG5829-RA (CG5829), mRNA 
0   NM_136495.2  CG2910-RB, transcript variant B (nito), mRNA 
0   NM_057892.3  CG4258-RA (dbe), mRNA 
0   NM_165579.1  CG2910-RA, transcript variant A (nito), mRNA 
0   NM_140792.1  CG6896-RA (MYPT-75D), mRNA 
0   NM_137678.2  CG30295-RA (Ipk1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.