National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7004R-2 
 Symbol fwd  Full Name four wheel drive 
 CG No CG7004  Old CG No CG7004 
 Synonyms CG7004, PI4K, anon-WO0118547.259, fwd 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pharate adult 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGGATCGGCGAATGGCACT 
 Primer Seq. 3'
aatctagaggtaccCTTACCGAGACGGACACGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGGATCGG CGAATGGCAC TGCTCCGGTG GAGGCAAAGC CAAACAATTG CTACCAGTAC 
0061 CTGCGCCACA TACGCGAAAT CGATACAAAC AACAAGCTCC TTTCTCCCGT CGTGGTTGTT 
0121 GCAGAGGAGA GGCCAGTGAG CAAGGCTGGT TCGCCCTCGA CAGTGGCGAC CATGGCTACT 
0181 GGAGTCGATG TGGTGGATCA CTGCCTGCCC ACAACGGTAC GATTGTCCGT TACCGAGGCG 
0241 CTATCCGACT TGAACATGAA CGGAAAAGCC GTCGAACCCC CCGTCACCCC ATGCACTTCG 
0301 GTTGGCGACA ATGCCAATCT GGAGGTGGCT GAAACATGGG CTTGTCCACC GCCACAAGCG 
0361 ACGGATGACG AGGACATATC CGAGCACTCG ACAGCCGCCT GCACCAGCAC AAGTAGCTCC 
0421 AGCGAGCACA GCAACAGCAC CGTGGTGCAC AGTCCAACTG TGGGGGAGAG CACCTGTGAC 
0481 TCCGTGTCCG TCTCGGTAAG  
 in silico PCR Fragment
0001 ATGGGATCGG CGAATGGCAC TGCTCCGGTG GAGGCAAAGC CAAACAATTG CTACCAGTAC 
0061 CTGCGCCACA TACGCGAAAT CGATACAAAC AACAAGCTCC TTTCTCCCGT CGTGGTTGTT 
0121 GCAGAGGAGA GGCCAGTGAG CAAGGCTGGT TCGCCCTCGA CAGTGGCGAC CATGGCTACT 
0181 GGAGTCGATG TGGTGGATCA CTGCCTGCCC ACAACGGTAC GATTGTCCGT TACCGAGGCG 
0241 CTATCCGACT TGAACATGAA CGGAAAAGCC GTCGAACCCC CCGTCACCCC ATGCACTTCG 
0301 GTTGGCGACA ATGCCAATCT GGAGGTGGCT GAAACATGGG CTTGTCCACC GCCACAAGCG 
0361 ACGGATGACG AGGACATATC CGAGCACTCG ACAGCCGCCT GCACCAGCAC AAGTAGCTCC 
0421 AGCGAGCACA GCAACAGCAC CGTGGTGCAC AGTCCAACTG TGGGGGAGAG CACCTGTGAC 
0481 TCCGTGTCCG TCTCGGTAAG  
 Assemble Data

7004R-2.IR full       1   ATGGGATCGGCGAATGGCACTGCTCCGGTGGAGGCAAAGCCAAACAATTGCTACCAGTAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7004R-2.in silico     1   ATGGGATCGGCGAATGGCACTGCTCCGGTGGAGGCAAAGCCAAACAATTGCTACCAGTAC 60


7004R-2.IR full       61  CTGCGCCACATACGCGAAATCGATACAAACAACAAGCTCCTTTCTCCCGTCGTGGTTGTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7004R-2.in silico     61  CTGCGCCACATACGCGAAATCGATACAAACAACAAGCTCCTTTCTCCCGTCGTGGTTGTT 120


7004R-2.IR full       121 GCAGAGGAGAGGCCAGTGAGCAAGGCTGGTTCGCCCTCGACAGTGGCGACCATGGCTACT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7004R-2.in silico     121 GCAGAGGAGAGGCCAGTGAGCAAGGCTGGTTCGCCCTCGACAGTGGCGACCATGGCTACT 180


7004R-2.IR full       181 GGAGTCGATGTGGTGGATCACTGCCTGCCCACAACGGTACGATTGTCCGTTACCGAGGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7004R-2.in silico     181 GGAGTCGATGTGGTGGATCACTGCCTGCCCACAACGGTACGATTGTCCGTTACCGAGGCG 240


7004R-2.IR full       241 CTATCCGACTTGAACATGAACGGAAAAGCCGTCGAACCCCCCGTCACCCCATGCACTTCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7004R-2.in silico     241 CTATCCGACTTGAACATGAACGGAAAAGCCGTCGAACCCCCCGTCACCCCATGCACTTCG 300


7004R-2.IR full       301 GTTGGCGACAATGCCAATCTGGAGGTGGCTGAAACATGGGCTTGTCCACCGCCACAAGCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7004R-2.in silico     301 GTTGGCGACAATGCCAATCTGGAGGTGGCTGAAACATGGGCTTGTCCACCGCCACAAGCG 360


7004R-2.IR full       361 ACGGATGACGAGGACATATCCGAGCACTCGACAGCCGCCTGCACCAGCACAAGTAGCTCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7004R-2.in silico     361 ACGGATGACGAGGACATATCCGAGCACTCGACAGCCGCCTGCACCAGCACAAGTAGCTCC 420


7004R-2.IR full       421 AGCGAGCACAGCAACAGCACCGTGGTGCACAGTCCAACTGTGGGGGAGAGCACCTGTGAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7004R-2.in silico     421 AGCGAGCACAGCAACAGCACCGTGGTGCACAGTCCAACTGTGGGGGAGAGCACCTGTGAC 480


7004R-2.IR full       481 TCCGTGTCCGTCTCGGTAAG 500
                          ||||||||||||||||||||
7004R-2.in silico     481 TCCGTGTCCGTCTCGGTAAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.