National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7003R-3 
 Symbol CG7003  Full Name CG7003 
 CG No CG7003  Old CG No CG7003 
 Synonyms Msh6, CG7003 
 Accession No (Link to NCBI) NM_140498.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCGATGCATCCAAGAGCGAAAAGGAGAATCTCCAGAACCAGCAGCCAAAAGTGAAGGATG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTAAGAAAGAGGCTTCCAAGCCGGCGGCCAAGAGGAAGTTGCCCATTTCCGACGATGAGC 120

                          ||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGCCAGTGGTCAACGCAAGCGGAAGCGCATCGTTCAGCCGGAATCGGACAGTGAGCCGG 180

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| silico     181 AAATGGAGGTAACCAAGTCGGAGGACGACTTCTCCGATTGCGCCTCCGACTAC-GAACCG 240

                          |||||||||||||||||||||||||||||||| ||||||||||  ||||||| ||||||| silico     241 GATGAGAATGAAGCCAGCGATGATAGCGTTAGCAGCGGCGCGG--AGGAGGT-GTCGCCT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCGAGAACGACATGTCCGTGGACAGTCCGACACCCAAGAAATCGCGCAAAAAGTCTAAG 360

                          |||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| silico     361 ATTCTGAATAACAACAATAACAAT-GAGCCATCGAGCAAGAAGGTCAAG-CTAGAGTCGA 420

                          |||||||||||||||||||  |||||| |||||||||||||||||||||||||||||||| silico     421 CCATCCAGTTGGCCGAGGG--TGCAAC-CTTTCAAGAAAAGCTGAAGAACCTGCAGAGCA 480

                          ||||||||||||||||||||||||||||| silico     481 ATGCCAAGCAGGATGCTTCCTACGATGAT 509

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140498.1  CG7003-RA (CG7003), mRNA 
0.62   NM_139485.1  CG12187-RA (CG12187), mRNA 
0.2   NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_139488.2  CG1240-RA (CG1240), mRNA 
0   NM_143452.1  CG1911-RA (CAP-D2), mRNA 
0   NM_206606.1  CG3806-RB, transcript variant B (eIF2B-epsilon), mRNA 
0   NM_130605.3  CG3806-RA, transcript variant A (eIF2B-epsilon), mRNA 
0   12  13  NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   21  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
0   NM_132213.1  CG2260-RA (CG2260), mRNA 
0   NM_001014486.1  CG4952-RG, transcript variant G (dac), mRNA 
0   NM_165159.1  CG4952-RC, transcript variant C (dac), mRNA 
0   NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 
0   NM_165162.1  CG4952-RB, transcript variant B (dac), mRNA 
0   NM_165161.1  CG4952-RD, transcript variant D (dac), mRNA 
0   NM_001014487.1  CG4952-RF, transcript variant F (dac), mRNA 
0   NM_165163.1  CG4952-RE, transcript variant E (dac), mRNA 
0   NM_079649.2  CG18740-RA (mor), mRNA 
0   NM_057430.3  CG5271-RA (RpS27A), mRNA 
0   NM_132606.1  CG3754-RA (CG3754), mRNA 
0   NM_135088.2  CG6907-RA (CG6907), mRNA 
0   NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_167222.1  CG32688-RB, transcript variant B (Hk), mRNA 
0   NM_166230.1  CG4816-RA, transcript variant A (qkr54B), mRNA 
0   NM_166231.1  CG4816-RC, transcript variant C (qkr54B), mRNA 
0   NM_079048.2  CG4816-RB, transcript variant B (qkr54B), mRNA 
0   NM_140597.1  CG13070-RA (CG13070), mRNA 
0   14  NM_169588.1  CG31317-RA, transcript variant A (stumps), mRNA 
0   14  NM_169589.1  CG31317-RB, transcript variant B (stumps), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.