National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7003R-2 
 Symbol CG7003  Full Name CG7003 
 CG No CG7003  Old CG No CG7003 
 Synonyms Msh6, CG7003 
 Accession No (Link to NCBI) NM_140498.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGATGCATCCAAGAGCGAAA 
 Primer Seq. 3'
aatctagaggtaccATCATCGTAGGAAGCATCCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCGNTGCATC CAAGAGCGAA AAGGAGAATC TCCAGAACCA GCAGCCAAAA GTGAAGGATG 
0061 GTAAGAAAGA GGCTTCCAAG CCGGCGGCCA AGAGGAAGTT GCCCATTTCC GACGATGAGC 
0121 CGATCAGTGG TCAACGCAAG CGGAAGCGCA TCGTTCAGCC GGAATCGGAC AGTGAGCCGG 
0181 AAATGGAGGT AACCAAGTCG GAGGACGACT TCTCCGATTG CGCCTCCGAC TACTGAACCG 
0241 GATGAGAATG AAGCCAGCGA TGATAGCGTT AGNAGCGGCG CGGNAAGGAG GTNGTCGCCT 
0301 AGCGAGAACG ACATGTCCGT GGACAGTCCG ACACCCAAGA AATCGCGCAA AAAGTCTAAG 
0361 ATTCTGAATA ACAACAATAA CAATGGAGCC ATCGAGCAAG AAGGTCAAGT CTAGAGTCGA 
0421 CCATCCAGTT GGCCGAGGGN NTGCAACTCT TTCAAGAAAA GCTGAAGAAC CTGCAGAGCA 
0481 ATGCCAAGCA GGATGCTTCC TACGATGAT 
 in silico PCR Fragment
0001 CCGATGCATC CAAGAGCGAA AAGGAGAATC TCCAGAACCA GCAGCCAAAA GTGAAGGATG 
0061 GTAAGAAAGA GGCTTCCAAG CCGGCGGCCA AGAGGAAGTT GCCCATTTCC GACGATGAGC 
0121 CGGCCAGTGG TCAACGCAAG CGGAAGCGCA TCGTTCAGCC GGAATCGGAC AGTGAGCCGG 
0181 AAATGGAGGT AACCAAGTCG GAGGACGACT TCTCCGATTG CGCCTCCGAC TAC-GAACCG 
0241 GATGAGAATG AAGCCAGCGA TGATAGCGTT AGCAGCGGCG CGG--AGGAG GT-GTCGCCT 
0301 AGCGAGAACG ACATGTCCGT GGACAGTCCG ACACCCAAGA AATCGCGCAA AAAGTCTAAG 
0361 ATTCTGAATA ACAACAATAA CAAT-GAGCC ATCGAGCAAG AAGGTCAAG- CTAGAGTCGA 
0421 CCATCCAGTT GGCCGAGGG- -TGCAAC-CT TTCAAGAAAA GCTGAAGAAC CTGCAGAGCA 
0481 ATGCCAAGCA GGATGCTTCC TACGATGAT 
 Assemble Data

7003R-2.IR_full       1   CCGNTGCATCCAAGAGCGAAAAGGAGAATCTCCAGAACCAGCAGCCAAAAGTGAAGGATG 60
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7003R-2.in silico     1   CCGATGCATCCAAGAGCGAAAAGGAGAATCTCCAGAACCAGCAGCCAAAAGTGAAGGATG 60


7003R-2.IR_full       61  GTAAGAAAGAGGCTTCCAAGCCGGCGGCCAAGAGGAAGTTGCCCATTTCCGACGATGAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7003R-2.in silico     61  GTAAGAAAGAGGCTTCCAAGCCGGCGGCCAAGAGGAAGTTGCCCATTTCCGACGATGAGC 120


7003R-2.IR_full       121 CGATCAGTGGTCAACGCAAGCGGAAGCGCATCGTTCAGCCGGAATCGGACAGTGAGCCGG 180
                          ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7003R-2.in silico     121 CGGCCAGTGGTCAACGCAAGCGGAAGCGCATCGTTCAGCCGGAATCGGACAGTGAGCCGG 180


7003R-2.IR_full       181 AAATGGAGGTAACCAAGTCGGAGGACGACTTCTCCGATTGCGCCTCCGACTACTGAACCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
7003R-2.in silico     181 AAATGGAGGTAACCAAGTCGGAGGACGACTTCTCCGATTGCGCCTCCGACTAC-GAACCG 240


7003R-2.IR_full       241 GATGAGAATGAAGCCAGCGATGATAGCGTTAGNAGCGGCGCGGNAAGGAGGTNGTCGCCT 300
                          |||||||||||||||||||||||||||||||| ||||||||||  ||||||| |||||||
7003R-2.in silico     241 GATGAGAATGAAGCCAGCGATGATAGCGTTAGCAGCGGCGCGG--AGGAGGT-GTCGCCT 300


7003R-2.IR_full       301 AGCGAGAACGACATGTCCGTGGACAGTCCGACACCCAAGAAATCGCGCAAAAAGTCTAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7003R-2.in silico     301 AGCGAGAACGACATGTCCGTGGACAGTCCGACACCCAAGAAATCGCGCAAAAAGTCTAAG 360


7003R-2.IR_full       361 ATTCTGAATAACAACAATAACAATGGAGCCATCGAGCAAGAAGGTCAAGTCTAGAGTCGA 420
                          |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||
7003R-2.in silico     361 ATTCTGAATAACAACAATAACAAT-GAGCCATCGAGCAAGAAGGTCAAG-CTAGAGTCGA 420


7003R-2.IR_full       421 CCATCCAGTTGGCCGAGGGNNTGCAACTCTTTCAAGAAAAGCTGAAGAACCTGCAGAGCA 480
                          |||||||||||||||||||  |||||| ||||||||||||||||||||||||||||||||
7003R-2.in silico     421 CCATCCAGTTGGCCGAGGG--TGCAAC-CTTTCAAGAAAAGCTGAAGAACCTGCAGAGCA 480


7003R-2.IR_full       481 ATGCCAAGCAGGATGCTTCCTACGATGAT 509
                          |||||||||||||||||||||||||||||
7003R-2.in silico     481 ATGCCAAGCAGGATGCTTCCTACGATGAT 509

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140498.1  CG7003-RA (CG7003), mRNA 
0.62   NM_139485.1  CG12187-RA (CG12187), mRNA 
0.2   NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_139488.2  CG1240-RA (CG1240), mRNA 
0   NM_143452.1  CG1911-RA (CAP-D2), mRNA 
0   NM_206606.1  CG3806-RB, transcript variant B (eIF2B-epsilon), mRNA 
0   NM_130605.3  CG3806-RA, transcript variant A (eIF2B-epsilon), mRNA 
0   12  13  NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   21  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
0   NM_132213.1  CG2260-RA (CG2260), mRNA 
0   NM_001014486.1  CG4952-RG, transcript variant G (dac), mRNA 
0   NM_165159.1  CG4952-RC, transcript variant C (dac), mRNA 
0   NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 
0   NM_165162.1  CG4952-RB, transcript variant B (dac), mRNA 
0   NM_165161.1  CG4952-RD, transcript variant D (dac), mRNA 
0   NM_001014487.1  CG4952-RF, transcript variant F (dac), mRNA 
0   NM_165163.1  CG4952-RE, transcript variant E (dac), mRNA 
0   NM_079649.2  CG18740-RA (mor), mRNA 
0   NM_057430.3  CG5271-RA (RpS27A), mRNA 
0   NM_132606.1  CG3754-RA (CG3754), mRNA 
0   NM_135088.2  CG6907-RA (CG6907), mRNA 
0   NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_167222.1  CG32688-RB, transcript variant B (Hk), mRNA 
0   NM_166230.1  CG4816-RA, transcript variant A (qkr54B), mRNA 
0   NM_166231.1  CG4816-RC, transcript variant C (qkr54B), mRNA 
0   NM_079048.2  CG4816-RB, transcript variant B (qkr54B), mRNA 
0   NM_140597.1  CG13070-RA (CG13070), mRNA 
0   14  NM_169588.1  CG31317-RA, transcript variant A (stumps), mRNA 
0   14  NM_169589.1  CG31317-RB, transcript variant B (stumps), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
VB
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.