National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6994R-1 
 Symbol CG32343  Full Name CG32343 
 CG No CG32343  Old CG No CG6994 
 Synonyms cg6994, CG6994, CG32343 
 Accession No (Link to NCBI) NM_167828.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGTCACGTCTACCCCATGGA 
 Primer Seq. 3'
aatctagaggtaccTGGAGACCAAGGTGACATCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGTCACGAC NGTCTACTCC CATGGAGAAC TCCAACCTGA TGCACTACGA GATCCGCACC 
0061 GAAGGGGATG TCCAGCAAAA GAAGGGGATC CTGGTGGGTC CGGCCACATG CGTTGACCTG 
0121 GGCAAACAGC TGCTCCAGTG CGCCAGAGAC AGCGATGTAG CTGGGGTCAA GGCGGCGCTA 
0181 NGCGCATGGN AGCTCCCTTC GCTTCCGACT GGCTAGGTAT GTCGGCACTT CACTTTGCCG 
0241 CCATGAACAA TCAGCTGGAG ATTTGCGAAA TCCTCCTGCA GGGGGGCATT AACATGGATG 
0301 GCAAGACCAA GGTAGACCGA ACGCCGCTCC ACCTAGCCTG CTACTACGGT CACGAGCGGA 
0361 TAGTCAGCTT NGCTGCTAGC GCTAAAGTGC AGCGTCAACT NCCCGCGACA TGCTTCGCAT 
0421 GACCCCGCTG CACTGGGCGG TCGAGAAAAA ACACAAGGGA ATTGTGCGCC TGCTACTCAA 
0481 GTGCCAGGCA GATGTCACCT TGGTCTCCA 
 in silico PCR Fragment
0001 TGGTCAC--- -GTCTAC-CC CATGGAGAAC TCCAACCTGA TGCACTACGA GATCCGCACC 
0061 GAAGGGGATG TCCAGCAAAA GAAGGGGATC CTGGTGGGTC CGGCCACATG CGTTGACCTG 
0121 GGCAAACAGC TGCTCCAGTG CGCCAGAGAC AGCGATGTAG CTGGGGTCAA GGCGGCGCTA 
0181 -GCGCATGG- AGCTCCCTTC GCTTCCGACT GGCTAGGTAT GTCGGCACTT CACTTTGCCG 
0241 CCATGAACAA TCAGCTGGAG ATTTGCGAAA TCCTCCTGCA GGGGGGCATT AACATGGATG 
0301 GCAAGACCAA GGTAGACCGA ACGCCGCTCC ACCTAGCCTG CTACTACGGT CACGAGCGGA 
0361 TAGTCAGCTT -GCTGCTAGC GCTAAAGTGC AGCGTCAACT -CCCGCGACA TGCTTCGCAT 
0421 GACCCCGCTG CACTGGGCGG TCGAGAAAAA ACACAAGGGA ATTGTGCGCC TGCTACTCAA 
0481 GTGCCAGGCA GATGTCACCT TGGTCTCCA 
 Assemble Data

6994R-1.IR_full       1   TGGTCACGACNGTCTACTCCCATGGAGAACTCCAACCTGATGCACTACGAGATCCGCACC 60
                          |||||||    |||||| ||||||||||||||||||||||||||||||||||||||||||
6994R-1.in silico     1   TGGTCAC----GTCTAC-CCCATGGAGAACTCCAACCTGATGCACTACGAGATCCGCACC 60


6994R-1.IR_full       61  GAAGGGGATGTCCAGCAAAAGAAGGGGATCCTGGTGGGTCCGGCCACATGCGTTGACCTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6994R-1.in silico     61  GAAGGGGATGTCCAGCAAAAGAAGGGGATCCTGGTGGGTCCGGCCACATGCGTTGACCTG 120


6994R-1.IR_full       121 GGCAAACAGCTGCTCCAGTGCGCCAGAGACAGCGATGTAGCTGGGGTCAAGGCGGCGCTA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6994R-1.in silico     121 GGCAAACAGCTGCTCCAGTGCGCCAGAGACAGCGATGTAGCTGGGGTCAAGGCGGCGCTA 180


6994R-1.IR_full        181 GCGCATGGNAGCTCCCTTCGCTTCCGACTGGCTAGGTATGTCGGCACTTCACTTTGCCG 239
                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
6994R-1.in silico      181 GCGCATGG-AGCTCCCTTCGCTTCCGACTGGCTAGGTATGTCGGCACTTCACTTTGCCG 239


6994R-1.IR_full       241 CCATGAACAATCAGCTGGAGATTTGCGAAATCCTCCTGCAGGGGGGCATTAACATGGATG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6994R-1.in silico     241 CCATGAACAATCAGCTGGAGATTTGCGAAATCCTCCTGCAGGGGGGCATTAACATGGATG 299


6994R-1.IR_full       301 GCAAGACCAAGGTAGACCGAACGCCGCTCCACCTAGCCTGCTACTACGGTCACGAGCGGA 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6994R-1.in silico     301 GCAAGACCAAGGTAGACCGAACGCCGCTCCACCTAGCCTGCTACTACGGTCACGAGCGGA 359


6994R-1.IR_full       361 TAGTCAGCTTNGCTGCTAGCGCTAAAGTGCAGCGTCAACTNCCCGCGACATGCTTCGCAT 419
                          |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||
6994R-1.in silico     361 TAGTCAGCTT-GCTGCTAGCGCTAAAGTGCAGCGTCAACT-CCCGCGACATGCTTCGCAT 419


6994R-1.IR_full       421 GACCCCGCTGCACTGGGCGGTCGAGAAAAAACACAAGGGAATTGTGCGCCTGCTACTCAA 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6994R-1.in silico     421 GACCCCGCTGCACTGGGCGGTCGAGAAAAAACACAAGGGAATTGTGCGCCTGCTACTCAA 479


6994R-1.IR_full       481 GTGCCAGGCAGATGTCACCTTGGTCTCCA 508
                          |||||||||||||||||||||||||||||
6994R-1.in silico     481 GTGCCAGGCAGATGTCACCTTGGTCTCCA 508

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167828.1  CG32343-RA (CG32343), mRNA 
0   NM_164576.2  CG15427-RD, transcript variant D (tutl), mRNA 
0   NM_080127.4  CG15427-RE, transcript variant E (tutl), mRNA 
0   NM_164577.1  CG15427-RC, transcript variant C (tutl), mRNA 
0   NM_164578.1  CG15427-RA, transcript variant A (tutl), mRNA 
0   NM_134517.2  CG15618-RA (CG15618), mRNA 
0   NM_135525.1  CG5604-RA (CG5604), mRNA 
0   NM_132944.2  CG13003-RA (CG13003), mRNA 
0   NM_165393.2  CG2225-RB, transcript variant B (CG2225), mRNA 
0   NM_165392.2  CG2225-RA, transcript variant A (CG2225), mRNA 
0   NM_001014497.1  CG2225-RF, transcript variant F (CG2225), mRNA 
0   NM_206020.2  CG2225-RE, transcript variant E (CG2225), mRNA 
0   NM_136274.2  CG2225-RC, transcript variant C (CG2225), mRNA 
0   NM_132539.2  CG1559-RA (Upf1), mRNA 
0   NM_167182.1  CG2194-RC, transcript variant C (Reg-3), mRNA 
0   NM_132310.2  CG2194-RB, transcript variant B (Reg-3), mRNA 
0   NM_079780.2  CG8333-RA (HLHmgamma), mRNA 
0   NM_133100.1  CG7095-RA (CG7095), mRNA 
0   NM_176715.1  CG7033-RC, transcript variant C (CG7033), mRNA 
0   NM_132296.2  CG7033-RA, transcript variant A (CG7033), mRNA 
0   NM_167176.1  CG7033-RB, transcript variant B (CG7033), mRNA 
0   NM_001032055.1  CG17291-RB, transcript variant B (Pp2A-29B), mRNA 
0   NM_001032056.1  CG17291-RA, transcript variant A (Pp2A-29B), mRNA 
0   NM_135239.1  CG18304-RA (CG18304), mRNA 
0   NM_138200.2  CG12030-RA (CG12030), mRNA 
0   NM_143297.1  CG3361-RA (mrt), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_078942.3  CG1978-RA (Or45a), mRNA 
0   NM_001015316.1  CG17514-PA.3 (CG17514), mRNA 
0   12  NM_141666.2  CG9492-RA (CG9492), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.