National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6983R-1 
 Symbol CG6983  Full Name CG6983 
 CG No CG6983  Old CG No CG6983 
 Synonyms CG6983 
 Accession No (Link to NCBI) NM_139970.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTGCGACGAGTCCATTGAA 
 Primer Seq. 3'
aatctagaggtaccTCATCGTCATCCCTCTCGACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGTGCGACG AGTCCATTGA AAATGTGGAG CATCAAGACC ACCATGTGCA CTTCGATACG 
0061 AACACGGTGA AGGATGACTT CGAATCGGAC AGCTGTGTGA CATACCAAAG GTCTGGTGAC 
0121 ACGATTGTGG TGAGCCTGGG CTTTCTGCAG ATCAGGCATC GCTATCTGAT CGAACTGAAG 
0181 CTGCCGACGT CGCTATTCGG CGATGCCAAG ACGCTGGCCA GCAAATTTGA GCCGGTGATT 
0241 AGCGCCACGC CGAGCTTGCA CTGCAGGATC ACGGAGTTCG AGGGCACCAA GCATGATGAG 
0301 CACGACTTTT TCGAAATGAA AATCGAGTTC TTTGCCTACA AGGAGAAGCT GTTGCGCGAG 
0361 GTCCTGCACA TTGTCAGCTC ATCGAACGCC AAGGNAGCTG CTACAGCTGG TCATAGCCGC 
0421 TCGGGTTGTT GGGCAAGGGC AAGGGTACTC CTATGCTGCN GGACCNGGAA TCCCATTGNC 
0481 ATCGGNCGTC GAGAGGGATG ACGATGA 
 in silico PCR Fragment
0001 ATGTGCGACG AGTCCATTGA AAATGTGGAG CATCAAGACC ACCATGTGCA CTTCGACACG 
0061 AACACGGTGA AGGATGACTT CGAATCGGAC AGCTGTGTGA CATACCAAAG GTCTGGTGAC 
0121 ACGATTGTGG TGAGCCTGGG CTTTCTGCAG ATCAGGCATC GCTATCTGAT CGAACTGAAG 
0181 CTGCCGACGT CGCTATTCGG CGATGCCAAG ACGCTGGCCA GCAAATTTGA GCCGGTGATT 
0241 AGCGCCACGC CGAGCTTGCA CTGCAGGATC ACGGAGTTCG AGGGCACCAA GCATGATGAG 
0301 CACGACTTTT TCGAAATGAA AATCGAGTTC TTTGCCTACA AGGAGAAGCT GTTGCGCGAG 
0361 GTCCTGCACA TTGTCAGCTC ATCGAACGCC AAGG-AGCTG CTACAGCTGG TCATAGCCGC 
0421 TCGGG-TGTT GGGCAAGGGC AAGGGTACTC CTATGCTGC- GGACT-GGAA T-CCATTG-C 
0481 ATCGG-CGTC GAGAGGGATG ACGATGA 
 Assemble Data

6983R-1.IR_full        1   TGTGCGACGAGTCCATTGAAAATGTGGAGCATCAAGACCACCATGTGCACTTCGATACG 59
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
6983R-1.in silico      1   TGTGCGACGAGTCCATTGAAAATGTGGAGCATCAAGACCACCATGTGCACTTCGACACG 59


6983R-1.IR_full       61  AACACGGTGAAGGATGACTTCGAATCGGACAGCTGTGTGACATACCAAAGGTCTGGTGAC 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6983R-1.in silico     61  AACACGGTGAAGGATGACTTCGAATCGGACAGCTGTGTGACATACCAAAGGTCTGGTGAC 119


6983R-1.IR_full       121 ACGATTGTGGTGAGCCTGGGCTTTCTGCAGATCAGGCATCGCTATCTGATCGAACTGAAG 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6983R-1.in silico     121 ACGATTGTGGTGAGCCTGGGCTTTCTGCAGATCAGGCATCGCTATCTGATCGAACTGAAG 179


6983R-1.IR_full       181 CTGCCGACGTCGCTATTCGGCGATGCCAAGACGCTGGCCAGCAAATTTGAGCCGGTGATT 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6983R-1.in silico     181 CTGCCGACGTCGCTATTCGGCGATGCCAAGACGCTGGCCAGCAAATTTGAGCCGGTGATT 239


6983R-1.IR_full       241 AGCGCCACGCCGAGCTTGCACTGCAGGATCACGGAGTTCGAGGGCACCAAGCATGATGAG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6983R-1.in silico     241 AGCGCCACGCCGAGCTTGCACTGCAGGATCACGGAGTTCGAGGGCACCAAGCATGATGAG 299


6983R-1.IR_full       301 CACGACTTTTTCGAAATGAAAATCGAGTTCTTTGCCTACAAGGAGAAGCTGTTGCGCGAG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6983R-1.in silico     301 CACGACTTTTTCGAAATGAAAATCGAGTTCTTTGCCTACAAGGAGAAGCTGTTGCGCGAG 359


6983R-1.IR_full       361 GTCCTGCACATTGTCAGCTCATCGAACGCCAAGGNAGCTGCTACAGCTGGTCATAGCCGC 419
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
6983R-1.in silico     361 GTCCTGCACATTGTCAGCTCATCGAACGCCAAGG-AGCTGCTACAGCTGGTCATAGCCGC 419


6983R-1.IR_full       421 TCGGGTTGTTGGGCAAGGGCAAGGGTACTCCTATGCTGCNGGACCNGGAATCCCATTGNC 479
                          ||||| ||||||||||||||||||||||||||||||||| ||||  ||||| |||||| |
6983R-1.in silico     421 TCGGG-TGTTGGGCAAGGGCAAGGGTACTCCTATGCTGC-GGACT-GGAAT-CCATTG-C 479


6983R-1.IR_full       481 ATCGGNCGTCGAGAGGGATGACGATGA 506
                          ||||| |||||||||||||||||||||
6983R-1.in silico     481 ATCGG-CGTCGAGAGGGATGACGATGA 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139970.2  CG6983-RA (CG6983), mRNA 
0   NM_136497.3  CG8726-RB, transcript variant B (CG8726), mRNA 
0   NM_165580.2  CG8726-RA, transcript variant A (CG8726), mRNA 
0   NM_058088.3  CG8730-RA (drosha), mRNA 
0   NM_078879.2  CG10363-RA (TepIV), mRNA 
0   NM_137449.2  CG5661-RA (Sema-5c), mRNA 
0   NM_166057.1  CG8787-RA, transcript variant A (Asx), mRNA 
0   NM_001014527.1  CG8787-RB, transcript variant B (Asx), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 
0   11  NM_079930.2  CG3856-RB, transcript variant B (Oamb), mRNA 
0   NM_057454.3  CG16720-RA, transcript variant A (5-HT1A), mRNA 
0   NM_169050.1  CG16708-RA, transcript variant A (CG16708), mRNA 
0   NM_141273.2  CG16708-RB, transcript variant B (CG16708), mRNA 
0   NM_166322.1  CG16720-RB, transcript variant B (5-HT1A), mRNA 
0   NM_079107.2  CG11173-RA (usnp), mRNA 
0   NM_140921.2  CG7365-RA (CG7365), mRNA 
0   NM_078556.3  CG1691-RA, transcript variant A (Imp), mRNA 
0   NM_167255.1  CG1691-RC, transcript variant C (Imp), mRNA 
0   NM_001042803.1  CG1691-RI, transcript variant I (Imp), mRNA 
0   NM_167254.2  CG1691-RB, transcript variant B (Imp), mRNA 
0   NM_167250.1  CG1691-RE, transcript variant E (Imp), mRNA 
0   NM_167249.1  CG1691-RD, transcript variant D (Imp), mRNA 
0   NM_167252.1  CG1691-RG, transcript variant G (Imp), mRNA 
0   NM_167253.1  CG1691-RH, transcript variant H (Imp), mRNA 
0   NM_167251.1  CG1691-RF, transcript variant F (Imp), mRNA 
0   NM_001043058.1  CG17800-RJ, transcript variant J (Dscam), mRNA 
0   12  NM_079039.2  CG8380-RA (DAT), mRNA 
0   NM_169334.2  CG3985-RD, transcript variant D (Syn), mRNA 
0   NM_176451.2  CG3985-RF, transcript variant F (Syn), mRNA 
0   NM_169332.2  CG3985-RA, transcript variant A (Syn), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.