National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6951R-3 
 Symbol CG6951  Full Name CG6951 
 CG No CG6951  Old CG No CG6951 
 Synonyms anon-WO0118547.579, CG6951 
 Accession No (Link to NCBI) NM_140940.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGCTCAAGATTTGATATCCC 
 Primer Seq. 3'
aatctagaggtaccCTTATATTCCACGCCCACTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCNCTCAAGA TTTGATATCC CAGTTGTCGA AGTCACCCGA AAGCCACAAG AGAAAGGAAT 
0061 ATCTGCATTG GGATGACTAC TTTATGGCCA CCTCACTGCT CTCCGCCAAA CGCAGCAAAG 
0121 ATCCCGTCAC CCAAGTGGGC GCCTGCATCG TGGATTCCCA GAATCGGATA GTGGCCATTG 
0181 GATACAATGG GTTCCCTCGC AACTGCAGCG ATGACGTGTT TCCGTGGTCA AAAGCTAAGA 
0241 AAGGCTCGCA GGAATTTGAT CCCCTGGAAG ACAAGAAGAT GTACGTGGTC CACGCGGAGG 
0301 CCAATGCAAT CCTGAACAGC AACGGCATGA GTTTGTCTGG AACTCGACTG TATACCACAC 
0361 TATTTCCGTG CAACGAATGT GCCAAACTCA TTATACAGGT GGGCATATCT CAGGTGCTAT 
0421 ATTTGTCCGA CAAGTATGCC GATAAGCCCA CATATCGTGC ATCCAAGCGG ATGCTGGATG 
0481 CAGTGGGCGT GGAATATAAG  
 in silico PCR Fragment
0001 CCGCTCAAGA TTTGATATCC CAGTTGTCGA AGTCACCCGA AAGCCACAAG AGAAAGGAAT 
0061 ATCTGCATTG GGATGACTAC TTTATGGCCA CCTCACTGCT CTCCGCCAAA CGCAGCAAAG 
0121 ATCCCGTCAC CCAAGTGGGC GCCTGCATCG TGGATTCCCA GAATCGGATA GTGGCCATTG 
0181 GATACAATGG GTTCCCTCGC AACTGCAGCG ATGACGTGTT TCCGTGGTCA AAAGCTAAGA 
0241 AAGGCTCGCA GGAATTTGAT CCCCTGGAAG ACAAGAAGAT GTACGTGGTC CACGCGGAGG 
0301 CCAATGCAAT CCTGAACAGC AACGGCATGA GTTTGTCTGG AACTCGACTG TATACCACAC 
0361 TATTTCCGTG CAACGAATGT GCCAAACTCA TTATACAGGT GGGCATATCT CAGGTGCTAT 
0421 ATTTGTCCGA CAAATATGCC GATAAGCCCA CATATCGTGC ATCCAAGCGG ATGCTGGATG 
0481 CAGTGGGCGT GGAATATAAG  
 Assemble Data

6951R-3.IR_full       1   CCNCTCAAGATTTGATATCCCAGTTGTCGAAGTCACCCGAAAGCCACAAGAGAAAGGAAT 60
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6951R-3.in silico     1   CCGCTCAAGATTTGATATCCCAGTTGTCGAAGTCACCCGAAAGCCACAAGAGAAAGGAAT 60


6951R-3.IR_full       61  ATCTGCATTGGGATGACTACTTTATGGCCACCTCACTGCTCTCCGCCAAACGCAGCAAAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6951R-3.in silico     61  ATCTGCATTGGGATGACTACTTTATGGCCACCTCACTGCTCTCCGCCAAACGCAGCAAAG 120


6951R-3.IR_full       121 ATCCCGTCACCCAAGTGGGCGCCTGCATCGTGGATTCCCAGAATCGGATAGTGGCCATTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6951R-3.in silico     121 ATCCCGTCACCCAAGTGGGCGCCTGCATCGTGGATTCCCAGAATCGGATAGTGGCCATTG 180


6951R-3.IR_full       181 GATACAATGGGTTCCCTCGCAACTGCAGCGATGACGTGTTTCCGTGGTCAAAAGCTAAGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6951R-3.in silico     181 GATACAATGGGTTCCCTCGCAACTGCAGCGATGACGTGTTTCCGTGGTCAAAAGCTAAGA 240


6951R-3.IR_full       241 AAGGCTCGCAGGAATTTGATCCCCTGGAAGACAAGAAGATGTACGTGGTCCACGCGGAGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6951R-3.in silico     241 AAGGCTCGCAGGAATTTGATCCCCTGGAAGACAAGAAGATGTACGTGGTCCACGCGGAGG 300


6951R-3.IR_full       301 CCAATGCAATCCTGAACAGCAACGGCATGAGTTTGTCTGGAACTCGACTGTATACCACAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6951R-3.in silico     301 CCAATGCAATCCTGAACAGCAACGGCATGAGTTTGTCTGGAACTCGACTGTATACCACAC 360


6951R-3.IR_full       361 TATTTCCGTGCAACGAATGTGCCAAACTCATTATACAGGTGGGCATATCTCAGGTGCTAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6951R-3.in silico     361 TATTTCCGTGCAACGAATGTGCCAAACTCATTATACAGGTGGGCATATCTCAGGTGCTAT 420


6951R-3.IR_full       421 ATTTGTCCGACAAGTATGCCGATAAGCCCACATATCGTGCATCCAAGCGGATGCTGGATG 480
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
6951R-3.in silico     421 ATTTGTCCGACAAATATGCCGATAAGCCCACATATCGTGCATCCAAGCGGATGCTGGATG 480


6951R-3.IR_full       481 CAGTGGGCGTGGAATATAAG 500
                          ||||||||||||||||||||
6951R-3.in silico     481 CAGTGGGCGTGGAATATAAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168838.1  CG6951-RB, transcript variant B (CG6951), mRNA 
100   482  NM_140940.1  CG6951-RA, transcript variant A (CG6951), mRNA 
0   NM_132110.1  CG3192-RA, transcript variant A (CG3192), mRNA 
0   NM_001031877.1  CG3192-RB, transcript variant B (CG3192), mRNA 
0   NM_135310.2  CG7115-RB, transcript variant B (CG7115), mRNA 
0   NM_164774.1  CG7115-RA, transcript variant A (CG7115), mRNA 
0   NM_134964.1  CG3921-RA (CG3921), mRNA 
0   NM_176162.1  CG33138-RA (CG33138), mRNA 
0   NM_136595.1  CG13744-RA (CG13744), mRNA 
0   NM_167778.1  CG14619-RB, transcript variant B (CG14619), mRNA 
0   NM_134618.2  CG14619-RA, transcript variant A (CG14619), mRNA 
0   NM_167775.1  CG14619-RD, transcript variant D (CG14619), mRNA 
0   NM_167777.1  CG14619-RC, transcript variant C (CG14619), mRNA 
0   NM_167776.1  CG14619-RE, transcript variant E (CG14619), mRNA 
0   NM_143711.2  CG1101-RA (Aly), mRNA 
0   NM_057220.3  CG17610-RA (grk), mRNA 
0   NM_132944.2  CG13003-RA (CG13003), mRNA 
0   NM_135238.2  CG10354-RA (CG10354), mRNA 
0   NM_080083.3  CG7004-RA, transcript variant A (fwd), mRNA 
0   NM_141822.2  CG14704-RA, transcript variant A (PGRP-LB), mRNA 
0   NM_169393.1  CG14704-RB, transcript variant B (PGRP-LB), mRNA 
0   NM_169392.1  CG14704-RC, transcript variant C (PGRP-LB), mRNA 
0   NM_166137.1  CG8405-RA (CG8405), mRNA 
0   NM_165234.1  CG31742-RA (CG31742), mRNA 
0   NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0   NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0   NM_080188.2  CG31359-RA (Hsp70Bb), mRNA 
0   NM_169441.1  CG31366-RA (Hsp70Aa), mRNA 
0   NM_141952.1  CG6489-RA (Hsp70Bc), mRNA 
0   NM_080059.2  CG18743-RA (Hsp70Ab), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.