National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6951R-2 
 Symbol CG6951  Full Name CG6951 
 CG No CG6951  Old CG No CG6951 
 Synonyms anon-WO0118547.579, CG6951 
 Accession No (Link to NCBI) NM_140940.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCGCTCAAGATTTGATATCCCAGTTGTCGAAGTCACCCGAAAGCCACAAGAGAAAGGAAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATCTGCATTGGGATGACTACTTTATGGCCACCTCACTGCTCTCCGCCAAACGCAGCAAAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATCCCGTCACCCAAGTGGGCGCCTGCATCGTGGATTCCCAGAATCGGATAGTGGCCATTG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GATACAATGGGTTCCCTCGCAACTGCAGCGATGACGTGTTTCCGTGGTCAAAAGCTAAGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGGCTCGCAGGAATTTGATCCCCTGGAAGACAAGAAGATGTACGTGGTCCACGCGGAGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCAATGCAATCCTGAACAGCAACGGCATGAGTTTGTCTGGAACTCGACTGTATACCACAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TATTTCCGTGCAACGAATGTGCCAAACTCATTATACAGGTGGGCATATCTCAGGTGCTAT 420

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATTTGTCCGACAAATATGCCGATAAGCCCACATATCGTGCATCCAAGCGGATGCTGGATG 480

6951R-2.IR_full       481 CAGTGGGCGTGGAATATAAG 500
                          |||||||||||||||||||| silico     481 CAGTGGGCGTGGAATATAAG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168838.1  CG6951-RB, transcript variant B (CG6951), mRNA 
100   482  NM_140940.1  CG6951-RA, transcript variant A (CG6951), mRNA 
0   NM_132110.1  CG3192-RA, transcript variant A (CG3192), mRNA 
0   NM_001031877.1  CG3192-RB, transcript variant B (CG3192), mRNA 
0   NM_135310.2  CG7115-RB, transcript variant B (CG7115), mRNA 
0   NM_164774.1  CG7115-RA, transcript variant A (CG7115), mRNA 
0   NM_134964.1  CG3921-RA (CG3921), mRNA 
0   NM_176162.1  CG33138-RA (CG33138), mRNA 
0   NM_136595.1  CG13744-RA (CG13744), mRNA 
0   NM_167778.1  CG14619-RB, transcript variant B (CG14619), mRNA 
0   NM_134618.2  CG14619-RA, transcript variant A (CG14619), mRNA 
0   NM_167775.1  CG14619-RD, transcript variant D (CG14619), mRNA 
0   NM_167777.1  CG14619-RC, transcript variant C (CG14619), mRNA 
0   NM_167776.1  CG14619-RE, transcript variant E (CG14619), mRNA 
0   NM_143711.2  CG1101-RA (Aly), mRNA 
0   NM_057220.3  CG17610-RA (grk), mRNA 
0   NM_132944.2  CG13003-RA (CG13003), mRNA 
0   NM_135238.2  CG10354-RA (CG10354), mRNA 
0   NM_080083.3  CG7004-RA, transcript variant A (fwd), mRNA 
0   NM_141822.2  CG14704-RA, transcript variant A (PGRP-LB), mRNA 
0   NM_169393.1  CG14704-RB, transcript variant B (PGRP-LB), mRNA 
0   NM_169392.1  CG14704-RC, transcript variant C (PGRP-LB), mRNA 
0   NM_166137.1  CG8405-RA (CG8405), mRNA 
0   NM_165234.1  CG31742-RA (CG31742), mRNA 
0   NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0   NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0   NM_080188.2  CG31359-RA (Hsp70Bb), mRNA 
0   NM_169441.1  CG31366-RA (Hsp70Aa), mRNA 
0   NM_141952.1  CG6489-RA (Hsp70Bc), mRNA 
0   NM_080059.2  CG18743-RA (Hsp70Ab), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.