National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6948R-4 
 Symbol Clc  Full Name Clathrin light chain 
 CG No CG6948  Old CG No CG6948 
 Synonyms CG6948, CLC, Clc 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCGCGGGAAGAGCCCGAAAA 
 Primer Seq. 3'
aatctagaggtaccCTAGGTGCTCTTCTGCACCTG 
 Predicted Fragment Size
367 
 IR fragment full Seq
0001 GTCGCGGGAA GAGCCCGAAA AGATACGCAA ATGGCGCGAA GAGCAAAAGC AACGACTGGA 
0061 GGAGAAGGAC ATCGAGGAGG AGCGAAAAAA GGAGGAACTC CGACAGCAGT CCAAGAAGGA 
0121 GCTGGACGAC TGGTTGCGCC AGATTGGCGA CTCCATATCG AAGACCAAAC TGGCGTCGCG 
0181 GAATGCCGAG AAACAAGCCG CCACCCTGGA GAATGGCACC ATCGAGCCGG GCACCGAATG 
0241 GGAGCGCATA GCCAAGCTCT GCGACTTCAA TCCCAAGGTG AACAAGGCGG GAAAGGACGT 
0301 CTCCCGCATG CGATCCATCT ACCTGCACCT CAAGCAGAAT CCCATCCAGG TGCAGAAGAG 
0361 CACCTAN 
 in silico PCR Fragment
0001 GTCGCGGGAA GAGCCCGAAA AGATACGCAA ATGGCGCGAA GAGCAAAAGC AACGACTGGA 
0061 GGAGAAGGAC ATCGAGGAGG AGCGAAAAAA GGAGGAACTC CGACAGCAGT CCAAGAAGGA 
0121 GCTGGACGAC TGGTTGCGCC AGATTGGCGA GTCCATATCG AAGACCAAAC TGGCGTCGCG 
0181 GAATGCCGAG AAACAAGCCG CCACCCTGGA GAATGGCACC ATCGAGCCGG GCACCGAATG 
0241 GGAGCGCATA GCCAAGCTCT GCGACTTCAA TCCCAAGGTG AACAAGGCGG GAAAGGACGT 
0301 CTCCCGCATG CGATCCATCT ACCTGCACCT CAAGCAGAAT CCCATCCAGG TGCAGAAGAG 
0361 CACCTAG 
 Assemble Data

6948R-4.IR full       1   GTCGCGGGAAGAGCCCGAAAAGATACGCAAATGGCGCGAAGAGCAAAAGCAACGACTGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6948R-4.in silico     1   GTCGCGGGAAGAGCCCGAAAAGATACGCAAATGGCGCGAAGAGCAAAAGCAACGACTGGA 60


6948R-4.IR full       61  GGAGAAGGACATCGAGGAGGAGCGAAAAAAGGAGGAACTCCGACAGCAGTCCAAGAAGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6948R-4.in silico     61  GGAGAAGGACATCGAGGAGGAGCGAAAAAAGGAGGAACTCCGACAGCAGTCCAAGAAGGA 120


6948R-4.IR full       121 GCTGGACGACTGGTTGCGCCAGATTGGCGACTCCATATCGAAGACCAAACTGGCGTCGCG 180
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
6948R-4.in silico     121 GCTGGACGACTGGTTGCGCCAGATTGGCGAGTCCATATCGAAGACCAAACTGGCGTCGCG 180


6948R-4.IR full       181 GAATGCCGAGAAACAAGCCGCCACCCTGGAGAATGGCACCATCGAGCCGGGCACCGAATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6948R-4.in silico     181 GAATGCCGAGAAACAAGCCGCCACCCTGGAGAATGGCACCATCGAGCCGGGCACCGAATG 240


6948R-4.IR full       241 GGAGCGCATAGCCAAGCTCTGCGACTTCAATCCCAAGGTGAACAAGGCGGGAAAGGACGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6948R-4.in silico     241 GGAGCGCATAGCCAAGCTCTGCGACTTCAATCCCAAGGTGAACAAGGCGGGAAAGGACGT 300


6948R-4.IR full       301 CTCCCGCATGCGATCCATCTACCTGCACCTCAAGCAGAATCCCATCCAGGTGCAGAAGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6948R-4.in silico     301 CTCCCGCATGCGATCCATCTACCTGCACCTCAAGCAGAATCCCATCCAGGTGCAGAAGAG 360


6948R-4.IR full       361 CACCTAN 367
                          |||||| 
6948R-4.in silico     361 CACCTAG 367

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.