National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6933R-2 
 Symbol CG6933  Full Name CG6933 
 CG No CG6933  Old CG No CG6933 
 Synonyms CG6933 
 Accession No (Link to NCBI) NM_140934.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAGGATCTGTGTCGTGGCC 
 Primer Seq. 3'
aatctagaggtaccCCGTTGACGCAGTTGATGTAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGAGGATCT GTGTCGTGGC CGCATGTCTC CTAATGGCAT CGCAGGCCAC CGGCTACACG 
0061 ATGGATGATC TGTGCCAACA GNTGGTCGGG CTATGGATAC ATCGGCAATC CGAGCAACTG 
0121 CCATGCCTGG GGATACTGCA AGAACCAGGA GGTTGTGGCC TGGGGCACCT GTCCCAACGG 
0181 CTTGGTGTTC AACGCCCAGG CCGGCAGCTG TGATTACGCT AATACCACGG TGTGCTCCAC 
0241 CAGTGCCGTT GAGACATGCT CCAACGTCAA ATCTCCCATG TATGTGGCCA ATCCGTTGAA 
0301 CTGCACCGAA TACGCCTACT GCGATGGCAC AGGCCAAATC TCCTATGGCG ATTGCGGCAC 
0361 CGGCGGCGTC TATTCGGCAT CCTCCACAAA ATGTATATGG GGACCCGCCT GCCCGCAGGA 
0421 CACCATCTGT CGGTTCATGT TGTCCAACAT CTTTGTAGGC GATCCGAACC AGTGCGGCAA 
0481 CTACATCANA CTGCGTCAAC gg 
 in silico PCR Fragment
0001 ATGAGGATCT GTGTCGTGGC CGCATGTCTC CTAATGGCAT CGCAGGCCAC CGGCTACACG 
0061 ATGGATGATC TGTGCCAACA G-TGGTCGGG CTATGGATAC ATCGGCAATC CGAGCAACTG 
0121 CCATGCCTGG GGATACTGCA AGAACCAGGA GGTTGTGGCC TGGGGCACCT GTCCCAACGG 
0181 CTTGGTGTTC AACGCGCAGG CCGGCAGCTG TGATTACGCT AATACCACGG TGTGCTCCAC 
0241 CAGTGCCGTT GAGACATGCT CCAACGTCAA ATCTCCCATG TATGTGGCCA ATCCGTTGAA 
0301 CTGCACCGAA TACGCCTACT GCGATGGCAC AGGCCAAATC TCCTATGGCG ATTGCGGCAC 
0361 CGGCGGCGTC TATTCGGCAT CCTCCACAAA ATGTATATGG GGACCCGCCT GCCCGCAGGA 
0421 CACCATCTGT CGGTTCATGT TGTCCAACAT CTTTGTAGGC GATCCGAACC AGTGCGGCAA 
0481 CTACATCA-A CTGCGTCAAC GG 
 Assemble Data

6933R-2.IR_full       1   ATGAGGATCTGTGTCGTGGCCGCATGTCTCCTAATGGCATCGCAGGCCACCGGCTACACG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6933R-2.in silico     1   ATGAGGATCTGTGTCGTGGCCGCATGTCTCCTAATGGCATCGCAGGCCACCGGCTACACG 60


6933R-2.IR_full       61  ATGGATGATCTGTGCCAACAGNTGGTCGGGCTATGGATACATCGGCAATCCGAGCAACTG 120
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
6933R-2.in silico     61  ATGGATGATCTGTGCCAACAG-TGGTCGGGCTATGGATACATCGGCAATCCGAGCAACTG 120


6933R-2.IR_full       121 CCATGCCTGGGGATACTGCAAGAACCAGGAGGTTGTGGCCTGGGGCACCTGTCCCAACGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6933R-2.in silico     121 CCATGCCTGGGGATACTGCAAGAACCAGGAGGTTGTGGCCTGGGGCACCTGTCCCAACGG 180


6933R-2.IR_full       181 CTTGGTGTTCAACGCCCAGGCCGGCAGCTGTGATTACGCTAATACCACGGTGTGCTCCAC 240
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
6933R-2.in silico     181 CTTGGTGTTCAACGCGCAGGCCGGCAGCTGTGATTACGCTAATACCACGGTGTGCTCCAC 240


6933R-2.IR_full       241 CAGTGCCGTTGAGACATGCTCCAACGTCAAATCTCCCATGTATGTGGCCAATCCGTTGAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6933R-2.in silico     241 CAGTGCCGTTGAGACATGCTCCAACGTCAAATCTCCCATGTATGTGGCCAATCCGTTGAA 300


6933R-2.IR_full       301 CTGCACCGAATACGCCTACTGCGATGGCACAGGCCAAATCTCCTATGGCGATTGCGGCAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6933R-2.in silico     301 CTGCACCGAATACGCCTACTGCGATGGCACAGGCCAAATCTCCTATGGCGATTGCGGCAC 360


6933R-2.IR_full       361 CGGCGGCGTCTATTCGGCATCCTCCACAAAATGTATATGGGGACCCGCCTGCCCGCAGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6933R-2.in silico     361 CGGCGGCGTCTATTCGGCATCCTCCACAAAATGTATATGGGGACCCGCCTGCCCGCAGGA 420


6933R-2.IR_full       421 CACCATCTGTCGGTTCATGTTGTCCAACATCTTTGTAGGCGATCCGAACCAGTGCGGCAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6933R-2.in silico     421 CACCATCTGTCGGTTCATGTTGTCCAACATCTTTGTAGGCGATCCGAACCAGTGCGGCAA 480


6933R-2.IR_full       481 CTACATCANACTGCGTCAACGG 502
                          |||||||| |||||||||||||
6933R-2.in silico     481 CTACATCA-ACTGCGTCAACGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140934.1  CG6933-RA, transcript variant A (CG6933), mRNA 
100   482  NM_168834.1  CG6933-RC, transcript variant C (CG6933), mRNA 
100   482  NM_168833.1  CG6933-RB, transcript variant B (CG6933), mRNA 
0   NM_057981.3  CG4063-RA (ebi), mRNA 
0   NM_079821.2  CG1954-RA (Pkc98E), mRNA 
0   NM_136852.1  CG13197-RA (CG13197), mRNA 
0   NM_143226.1  CG5467-RA (CG5467), mRNA 
0   NM_001038859.1  CG8585-RE, transcript variant E (Ih), mRNA 
0   NM_001038856.1  CG8585-RC, transcript variant C (Ih), mRNA 
0   NM_001038858.1  CG8585-RB, transcript variant B (Ih), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_166773.1  CG1909-RB, transcript variant B (CG1909), mRNA 
0   NM_143671.2  CG1909-RA, transcript variant A (CG1909), mRNA 
0   NM_136058.3  CG10346-RA (Grip71), mRNA 
0   NM_137921.1  CG30188-RA (CG30188), mRNA 
0   NM_176106.1  CG33141-RA, transcript variant A (sns), mRNA 
0   NM_001043067.1  CG33141-RB, transcript variant B (sns), mRNA 
0   NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
0   NM_078500.3  CG4317-RA (Mipp2), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_143391.1  CG11828-RA (CG11828), mRNA 
0   NM_135124.1  CG14001-RA (bchs), mRNA 
0   NM_142259.2  CG10278-RA (GATAe), mRNA 
0   NM_167474.1  CG8909-RB (CG8909), mRNA 
0   NM_057810.3  CG11567-RA, transcript variant A (Cpr), mRNA 
0   11  NM_140264.1  CG5897-RA (CG5897), mRNA 
0   NM_141568.2  CG9797-RA (CG9797), mRNA 
0   NM_135708.1  CG17211-RA (CG17211), mRNA 
0   NM_166668.1  CG4356-RA, transcript variant A (mAcR-60C), mRNA 
0   NM_079120.2  CG4356-RB, transcript variant B (mAcR-60C), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.