National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6933R-1 
 Symbol CG6933  Full Name CG6933 
 CG No CG6933  Old CG No CG6933 
 Synonyms CG6933 
 Accession No (Link to NCBI) NM_140934.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGAGGATCTGTGTCGTGGCCGCATGTCTCCTAATGGCATCGCAGGCCACCGGCTACACG 60

                          ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| silico     61  ATGGATGATCTGTGCCAACAG-TGGTCGGGCTATGGATACATCGGCAATCCGAGCAACTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCATGCCTGGGGATACTGCAAGAACCAGGAGGTTGTGGCCTGGGGCACCTGTCCCAACGG 180

                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     181 CTTGGTGTTCAACGCGCAGGCCGGCAGCTGTGATTACGCTAATACCACGGTGTGCTCCAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGTGCCGTTGAGACATGCTCCAACGTCAAATCTCCCATGTATGTGGCCAATCCGTTGAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGCACCGAATACGCCTACTGCGATGGCACAGGCCAAATCTCCTATGGCGATTGCGGCAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGGCGGCGTCTATTCGGCATCCTCCACAAAATGTATATGGGGACCCGCCTGCCCGCAGGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CACCATCTGTCGGTTCATGTTGTCCAACATCTTTGTAGGCGATCCGAACCAGTGCGGCAA 480

6933R-1.IR_full       481 CTACATCANACTGCGTCAACGG 502
                          |||||||| ||||||||||||| silico     481 CTACATCA-ACTGCGTCAACGG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140934.1  CG6933-RA, transcript variant A (CG6933), mRNA 
100   482  NM_168834.1  CG6933-RC, transcript variant C (CG6933), mRNA 
100   482  NM_168833.1  CG6933-RB, transcript variant B (CG6933), mRNA 
0   NM_057981.3  CG4063-RA (ebi), mRNA 
0   NM_079821.2  CG1954-RA (Pkc98E), mRNA 
0   NM_136852.1  CG13197-RA (CG13197), mRNA 
0   NM_143226.1  CG5467-RA (CG5467), mRNA 
0   NM_001038859.1  CG8585-RE, transcript variant E (Ih), mRNA 
0   NM_001038856.1  CG8585-RC, transcript variant C (Ih), mRNA 
0   NM_001038858.1  CG8585-RB, transcript variant B (Ih), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_166773.1  CG1909-RB, transcript variant B (CG1909), mRNA 
0   NM_143671.2  CG1909-RA, transcript variant A (CG1909), mRNA 
0   NM_136058.3  CG10346-RA (Grip71), mRNA 
0   NM_137921.1  CG30188-RA (CG30188), mRNA 
0   NM_176106.1  CG33141-RA, transcript variant A (sns), mRNA 
0   NM_001043067.1  CG33141-RB, transcript variant B (sns), mRNA 
0   NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
0   NM_078500.3  CG4317-RA (Mipp2), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_143391.1  CG11828-RA (CG11828), mRNA 
0   NM_135124.1  CG14001-RA (bchs), mRNA 
0   NM_142259.2  CG10278-RA (GATAe), mRNA 
0   NM_167474.1  CG8909-RB (CG8909), mRNA 
0   NM_057810.3  CG11567-RA, transcript variant A (Cpr), mRNA 
0   11  NM_140264.1  CG5897-RA (CG5897), mRNA 
0   NM_141568.2  CG9797-RA (CG9797), mRNA 
0   NM_135708.1  CG17211-RA (CG17211), mRNA 
0   NM_166668.1  CG4356-RA, transcript variant A (mAcR-60C), mRNA 
0   NM_079120.2  CG4356-RB, transcript variant B (mAcR-60C), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.