National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6917R-2 
 Symbol Est-6  Full Name Esterase 6 
 CG No CG6917  Old CG No CG6917 
 Synonyms EST-6, CG6917, EST-5, Est6, est-6, EST6, Est, est6, Est-5, Est-D, Est-6, Est-5B 
 Accession No (Link to NCBI) NM_176322.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Younus F, Fraser NJ, Coppin CW, Liu JW, Correy GJ, Chertemps T, Pandey G, Maïbèche M, Jackson CJ, Oakeshott JG.
Molecular basis for the behavioral effects of the odorant degrading enzyme Esterase 6 in Drosophila.
Sci Rep (2017) 7 46188 [ PubMed ID = 28393888 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACGTGGGACTGGGACTTATC 
 Primer Seq. 3'
aatctagaggtaccCCGGTGCTCACGAAACCCAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACGTGGGAC TGGGACTTAT CATTGTGCTG AGCTGCCTTT NGcTCGGTTC GAACGCGAGT 
0061 GATACAGATG ACCCTCTGTT GGTGCAGCTG CCCCAGGGCA AGCTACGTGG TCGCGATAAT 
0121 GGAAGCTACT ACAGCTACGA ATCGATTCCC TACGCCGAAC CGCCCACTGG CGATCATACG 
0181 ATTCGAGGCT CCAGAGCCGT ACAAACAAAA GTGGTCGGAT ATATTCGATG CCACCAAAAC 
0241 CCCGGTGGCG TGCCTGCAGT GGAGATCAGT TCACGCCTGG GGCCAACAAA TTGGTAGGAG 
0301 AGGAGGATTG CCTAACCGTC AGCGTCTACA AGCCGAAGAA TAGCAAGAGG AATAGCTTTC 
0361 CGGTGGTGGC CCACATTCAC GGAGGTGCCT TATATGTTCG GTGCAGCATG GCAAAATGGA 
0421 CACGAGAACG TGATGCGTGA GGGCAAATTC ATTCTGGTGA AGATAagNTA TCgCCTGGGG 
0481 CCATTGGGTT TCGTGAGCAC CGG 
 in silico PCR Fragment
0001 TACGTGGGAC TGGGACTTAT CATTGTGCTG AGCTGCCTTT GGCTCGGTTC GAACGCGAGT 
0061 GATACAGATG ACCCTCTGTT GGTGCAGCTG CCCCAGGGCA AGCTACGTGG TCGCGATAAT 
0121 GGAAGCTACT ACAGCTACGA ATCGATTCCC TACGCCGAAC CGCCCACTGG CGATC-TACG 
0181 ATTCGAGGCT CCAGAGCCGT ACAAACAAAA GTGGTCGGAT ATATTCGATG CCACCAAAAC 
0241 CCCGGTGGCG TGCCTGCAGT GG-GATCAGT TCACGCCTGG GGCCAACAAA TTGGTAGGAG 
0301 AGGAGGATTG CCTAACCGTC AGCGTCTACA AGCCGAAGAA TAGCAAGAGG AATAGCTTTC 
0361 CGGTGGTGGC CCACATTCAC GGAGGTGCCT T-TATGTTCG GTGCAGCATG GCAAAATGGA 
0421 CACGAGAACG TGATGCGTGA GGGCAAATTC ATTCTGGTGA AGATAAGCTA TCGCCTGGGG 
0481 CCATTGGGTT TCGTGAGCAC CGG 
 Assemble Data

6917R-2.IR_full       1   TACGTGGGACTGGGACTTATCATTGTGCTGAGCTGCCTTTNGCTCGGTTCGAACGCGAGT 60
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
6917R-2.in silico     1   TACGTGGGACTGGGACTTATCATTGTGCTGAGCTGCCTTTGGCTCGGTTCGAACGCGAGT 60


6917R-2.IR_full       61  GATACAGATGACCCTCTGTTGGTGCAGCTGCCCCAGGGCAAGCTACGTGGTCGCGATAAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6917R-2.in silico     61  GATACAGATGACCCTCTGTTGGTGCAGCTGCCCCAGGGCAAGCTACGTGGTCGCGATAAT 120


6917R-2.IR_full       121 GGAAGCTACTACAGCTACGAATCGATTCCCTACGCCGAACCGCCCACTGGCGATCATACG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
6917R-2.in silico     121 GGAAGCTACTACAGCTACGAATCGATTCCCTACGCCGAACCGCCCACTGGCGATC-TACG 180


6917R-2.IR_full       181 ATTCGAGGCTCCAGAGCCGTACAAACAAAAGTGGTCGGATATATTCGATGCCACCAAAAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6917R-2.in silico     181 ATTCGAGGCTCCAGAGCCGTACAAACAAAAGTGGTCGGATATATTCGATGCCACCAAAAC 240


6917R-2.IR_full       241 CCCGGTGGCGTGCCTGCAGTGGAGATCAGTTCACGCCTGGGGCCAACAAATTGGTAGGAG 300
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
6917R-2.in silico     241 CCCGGTGGCGTGCCTGCAGTGG-GATCAGTTCACGCCTGGGGCCAACAAATTGGTAGGAG 300


6917R-2.IR_full       301 AGGAGGATTGCCTAACCGTCAGCGTCTACAAGCCGAAGAATAGCAAGAGGAATAGCTTTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6917R-2.in silico     301 AGGAGGATTGCCTAACCGTCAGCGTCTACAAGCCGAAGAATAGCAAGAGGAATAGCTTTC 360


6917R-2.IR_full       361 CGGTGGTGGCCCACATTCACGGAGGTGCCTTATATGTTCGGTGCAGCATGGCAAAATGGA 420
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
6917R-2.in silico     361 CGGTGGTGGCCCACATTCACGGAGGTGCCTT-TATGTTCGGTGCAGCATGGCAAAATGGA 420


6917R-2.IR_full       421 CACGAGAACGTGATGCGTGAGGGCAAATTCATTCTGGTGAAGATAAGNTATCGCCTGGGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
6917R-2.in silico     421 CACGAGAACGTGATGCGTGAGGGCAAATTCATTCTGGTGAAGATAAGCTATCGCCTGGGG 480


6917R-2.IR_full       481 CCATTGGGTTTCGTGAGCACCGG 503
                          |||||||||||||||||||||||
6917R-2.in silico     481 CCATTGGGTTTCGTGAGCACCGG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176322.1  CG6917-RA (Est-6), mRNA 
1.24   13  23  NM_176323.1  CG17148-RA (Est-P), mRNA 
0   NM_136046.2  CG15161-RA (CG15161), mRNA 
0   NM_140832.2  CG11577-RA (CG11577), mRNA 
0   NM_079492.2  CG11401-RA (Trxr-2), mRNA 
0   NM_143932.1  CG11985-RA (CG11985), mRNA 
0   NM_135188.2  CG9535-RA, transcript variant A (CG9535), mRNA 
0   NM_164690.1  CG9535-RB, transcript variant B (CG9535), mRNA 
0   NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
0   NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
0   NM_079769.2  CG11783-RA (Hr96), mRNA 
0   NM_137711.3  CG30389-RA, transcript variant A (CG30389), mRNA 
0   NM_137712.3  CG30389-RC, transcript variant C (CG30389), mRNA 
0   NM_166428.2  CG30389-RB, transcript variant B (CG30389), mRNA 
0   NM_142292.1  CG14897-RB, transcript variant B (CG14897), mRNA 
0   NM_165549.2  CG1399-RA, transcript variant A (CG1399), mRNA 
0   NM_136472.3  CG1399-RB, transcript variant B (CG1399), mRNA 
0   NM_169720.1  CG14897-RA, transcript variant A (CG14897), mRNA 
0   NM_165550.1  CG30493-RB (CG30493), mRNA 
0   NM_167219.1  CG32691-RA (CG32691), mRNA 
0   NM_135544.2  CG5045-RA (CG5045), mRNA 
0   10  NM_142972.3  CG6204-RA (CG6204), mRNA 
0   NM_138066.2  CG15873-RA (CG15873), mRNA 
0   NM_135830.3  CG16863-RA, transcript variant A (CG16863), mRNA 
0   NM_001042896.1  CG16863-RB, transcript variant B (CG16863), mRNA 
0   NM_137151.2  CG10212-RA (SMC2), mRNA 
0   NM_142563.1  CG16718-RA, transcript variant A (CG16718), mRNA 
0   NM_135297.2  CG7214-RA (CG7214), mRNA 
0   NM_169867.1  CG16718-RB, transcript variant B (CG16718), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.