National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6914R-2 
 Symbol CG6914  Full Name CG6914 
 CG No CG6914  Old CG No CG6914 
 Synonyms BcDNA:AT13913, CG6914 
 Accession No (Link to NCBI) NM_141142.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTCCGAAACCCAAGCATCGC 
 Primer Seq. 3'
aatctagaggtaccTGGCCCCTCCCAAGAATGCAC 
 Predicted Fragment Size
429 
 IR fragment full Seq
0001 CCTCCGAAAN CCCAAGCATC GCGGACGTAG CCGGCTTTCT CAGCCGGGTG CGCAACTTCC 
0061 TGCTGGGCCG CACCCACAAG ACGGCCcATC GCTTCGCGGA CATGGTCTCT CCGCGCACTC 
0121 AGCCGCCCCC AAACATCCCT AGTGGTCCTA CCCAGAGTCT GTTCGCCAAC TACTACTACA 
0181 CCAGGGATCC TCGGCGCTTG GTGAAGCCCT TCGTCGACGT GGTGCAGGAG CACAAGAAGA 
0241 TNNTCACCGC CAAGGTGAAG GAGGAGGAAG CAGCCAAAAA GGCTCAGGCC AAGTCTGGAG 
0301 ATGCGCCGAA AGATGGTAGC CCCATTCCAC CTGTCGGGCC CAAGACTACT GATACAAATG 
0361 AATGCGATGA AGGCAATTCC GGCGCGAAGA AGCTCCCGAC TCCAGGAAAG GTGCATTCTT 
0421 GGGAGGGGCC A 
 in silico PCR Fragment
0001 CCTCCGAAA- CCCAAGCATC GC-GACGTAG CCGGCTTTCT CAGCCGGGTG CGCAACTTCC 
0061 TGCTGGGCCG CACCCACAAG ACGGCCCATC GCTTCGCGGA CATGGTCTCT CCGCGCACTC 
0121 AGCCGCCCCC AAACATCCCT AGTGGTCCTA CCCAGAGTCT GTTCGCCAAC TACTACTACA 
0181 CCAGGGATCC TCGGCGCTTG GTGAAGCCCT TCGTCGACGT GGTGCAGGAG CACAAGAAGA 
0241 TGCTCACCGC CAAGGTGAAG GAGGAGGAAG CAGCCAAAAA GGCTCAGGCC AAGTCTGGAG 
0301 ATGCGCCGAA AGATGGTAGC CCCATTCCAC CTGTCGGGCC CAAGACTACT GATACAAATG 
0361 AATGCGATGA AGGCAATTCC GGCGCGAAGA AGCTCCCGAC TCCAGGAAAG GTGCATTCTT 
0421 GGGAGGGGCC A 
 Assemble Data

6914R-2.IR_full       1   CCTCCGAAANCCCAAGCATCGCGGACGTAGCCGGCTTTCTCAGCCGGGTGCGCAACTTCC 60
                          ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||
6914R-2.in silico     1   CCTCCGAAA-CCCAAGCATCGC-GACGTAGCCGGCTTTCTCAGCCGGGTGCGCAACTTCC 60


6914R-2.IR_full       61  TGCTGGGCCGCACCCACAAGACGGCCCATCGCTTCGCGGACATGGTCTCTCCGCGCACTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6914R-2.in silico     61  TGCTGGGCCGCACCCACAAGACGGCCCATCGCTTCGCGGACATGGTCTCTCCGCGCACTC 120


6914R-2.IR_full       121 AGCCGCCCCCAAACATCCCTAGTGGTCCTACCCAGAGTCTGTTCGCCAACTACTACTACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6914R-2.in silico     121 AGCCGCCCCCAAACATCCCTAGTGGTCCTACCCAGAGTCTGTTCGCCAACTACTACTACA 180


6914R-2.IR_full       181 CCAGGGATCCTCGGCGCTTGGTGAAGCCCTTCGTCGACGTGGTGCAGGAGCACAAGAAGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6914R-2.in silico     181 CCAGGGATCCTCGGCGCTTGGTGAAGCCCTTCGTCGACGTGGTGCAGGAGCACAAGAAGA 240


6914R-2.IR_full       241 TNNTCACCGCCAAGGTGAAGGAGGAGGAAGCAGCCAAAAAGGCTCAGGCCAAGTCTGGAG 300
                          |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6914R-2.in silico     241 TGCTCACCGCCAAGGTGAAGGAGGAGGAAGCAGCCAAAAAGGCTCAGGCCAAGTCTGGAG 300


6914R-2.IR_full       301 ATGCGCCGAAAGATGGTAGCCCCATTCCACCTGTCGGGCCCAAGACTACTGATACAAATG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6914R-2.in silico     301 ATGCGCCGAAAGATGGTAGCCCCATTCCACCTGTCGGGCCCAAGACTACTGATACAAATG 360


6914R-2.IR_full       361 AATGCGATGAAGGCAATTCCGGCGCGAAGAAGCTCCCGACTCCAGGAAAGGTGCATTCTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6914R-2.in silico     361 AATGCGATGAAGGCAATTCCGGCGCGAAGAAGCTCCCGACTCCAGGAAAGGTGCATTCTT 420


6914R-2.IR_full       421 GGGAGGGGCCA 431
                          |||||||||||
6914R-2.in silico     421 GGGAGGGGCCA 431

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   411  NM_141142.1  CG6914-RA (CG6914), mRNA 
0.24   NM_167608.1  CG7178-RG, transcript variant G (wupA), mRNA 
0.24   NM_078674.2  CG7178-RC, transcript variant C (wupA), mRNA 
0.24   NM_167604.1  CG7178-RD, transcript variant D (wupA), mRNA 
0.24   NM_167606.1  CG7178-RB, transcript variant B (wupA), mRNA 
0.24   NM_167607.1  CG7178-RA, transcript variant A (wupA), mRNA 
0.24   NM_167603.1  CG7178-RF, transcript variant F (wupA), mRNA 
0.24   NM_167605.1  CG7178-RE, transcript variant E (wupA), mRNA 
0   NM_133099.1  CG7058-RA (CG7058), mRNA 
0   NM_167210.1  CG32694-RC, transcript variant C (CG32694), mRNA 
0   NM_167209.1  CG32694-RA, transcript variant A (CG32694), mRNA 
0   NM_001038953.1  CG10045-RB, transcript variant B (GstD1), mRNA 
0   NM_079602.3  CG10045-RA, transcript variant A (GstD1), mRNA 
0   NM_164967.1  CG6509-RA, transcript variant A (CG6509), mRNA 
0   NM_135661.2  CG6509-RB, transcript variant B (CG6509), mRNA 
0   NM_132066.1  CG4320-RA (raptor), mRNA 
0   NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0   NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0   NM_167435.2  CG6146-RB, transcript variant B (Top1), mRNA 
0   NM_164515.2  CG3059-RD, transcript variant D (NTPase), mRNA 
0   NM_140854.1  CG9594-RA (Chd3), mRNA 
0   NM_164513.2  CG3059-RB, transcript variant B (NTPase), mRNA 
0   NM_164514.2  CG3059-RC, transcript variant C (NTPase), mRNA 
0   NM_058022.3  CG3059-RA, transcript variant A (NTPase), mRNA 
0   NM_167946.1  CG32299-RA (CG32299), mRNA 
0   19  NM_168940.1  CG7421-RB, transcript variant B (Nopp140), mRNA 
0   17  NM_168941.2  CG7421-RA, transcript variant A (Nopp140), mRNA 
0   NM_169059.1  CG2902-RA (Nmdar1), mRNA 
0   NM_170524.1  CG12072-RA (wts), mRNA 
0   NM_137061.2  CG6337-RA (CG6337), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.