National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6910R-3 
 Symbol CG6910  Full Name CG6910 
 CG No CG6910  Old CG No CG6910 
 Synonyms CG6910 
 Accession No (Link to NCBI) NM_140299.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     1   ATGCGTCCTGAGCCCACATTCGCGGACAAGAATCCCTCCAAATT-CCGGGACTACAGTAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGACACCACCGATCCTCTAAAGGAACGTGTGCGCCAGACTTATCGTCAGATGCATCTGAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCAGACTGTGGATTTCGTCAAGGGTCGTCGTGAGCACTGGCTGAAGTTTAACACGATTAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GATGACTGTGCGCGAAGCTTTGGAGAAGCTGAACGATTTGGTCGACGAATCGGATCCCGA 240

                          |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     241 CCTGGATCTGCCTAACATCATCCACGCCTTCCAGGCTGCTGA-GCGGGCACGCGCCGAAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTCCGGAGCACGACTGGCTGCATCTTACGGCGCTCATTCACGATCTGGGTAAGATCATGG 360

                          |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| silico     361 CCTTCTACGGCGAGCCGCAGTGGGCGGTGGTTGGCGACACCTTCGCCGTGGGCTGCCGTT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGGGGGATAGCATTGTGTACCGGGACGAGAGCTTCGAGGGAAATCCAGATGGGGATAATC 480

6910R-3.IR_full       481 CCGCCTACAACACCGAACTGGG 502
                          |||||||||||||||||||||| silico     481 CCGCCTACAACACCGAACTGGG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140299.1  CG6910-RA (CG6910), mRNA 
0   NM_135257.1  CG4496-RA (CG4496), mRNA 
0   NM_139714.3  CG10624-RA (sinu), mRNA 
0   NM_140093.1  CG18178-RA (CG18178), mRNA 
0   NM_139969.2  CG7015-RA (Unr), mRNA 
0   NM_168908.1  CG7199-RC, transcript variant C (Hr78), mRNA 
0   NM_168907.1  CG7199-RB, transcript variant B (Hr78), mRNA 
0   NM_079479.3  CG7199-RA, transcript variant A (Hr78), mRNA 
0   NM_206415.1  CG7199-RD, transcript variant D (Hr78), mRNA 
0   NM_132780.1  CG15029-RA (CG15029), mRNA 
0   NM_140985.2  CG4825-RA (CG4825), mRNA 
0   NM_079344.2  CG3836-RA (stwl), mRNA 
0   NM_170534.1  CG1462-RB, transcript variant B (Aph-4), mRNA 
0   NM_169084.1  CG31546-RA (CG31546), mRNA 
0   NM_080356.2  CG5993-RA (os), mRNA 
0   NM_166992.2  CG2904-RA (ec), mRNA 
0   NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_137509.2  CG5482-RA (CG5482), mRNA 
0   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0   NM_138122.2  CG30422-RA (egg), mRNA 
0   NM_142062.1  CG14363-RA (CG14363), mRNA 
0   NM_166709.2  CG30428-RA (CG30428), mRNA 
0   NM_139421.3  CG5687-RA (CG5687), mRNA 
0   NM_165554.2  CG18812-RA, transcript variant A (CG18812), mRNA 
0   NM_165553.2  CG18812-RB, transcript variant B (CG18812), mRNA 
0   NM_165552.2  CG18812-RC, transcript variant C (CG18812), mRNA 
0   NM_137059.2  CG13339-RA (CG13339), mRNA 
0   NM_142913.1  CG10254-RA, transcript variant A (CG10254), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.