National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6910R-1 
 Symbol CG6910  Full Name CG6910 
 CG No CG6910  Old CG No CG6910 
 Synonyms CG6910 
 Accession No (Link to NCBI) NM_140299.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCGTCCTGAGCCCACATTC 
 Primer Seq. 3'
aatctagaggtaccCCCAGTTCGGTGTTGTAGGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCGTCCTG AGCCCACATT CGCGGACAAG AATCCCTCCA AATTNCCGGG ACTACAGTAT 
0061 GGACACCACC GATCCTCTAA AGGAACGTGT GCGCCAGACT TATCGTCAGA TGCATCTGAA 
0121 CCAGACTGTG GATTTCGTCA AGGGTCGTCG TGAGCACTGG CTGAAGTTTA ACACGATTAA 
0181 GATGACTGTG CGCGAAGCTT TGGAGAAGCT GAACGATTTG GTCGACGAAT CGGATCCCGA 
0241 CCTGGATCTG CCTAACATCA TCCACGCCTT CCAGGCTGCT GANGCGGGCA CGCGCCGAAT 
0301 TTCCGGAGCA CGACTGGCTG CATCTTACGG CGCTCATTCA CGATCTGGGT AAGATCATGG 
0361 CCTTCTACgG CGAGcCGCAG TGGGCGGTGG TTGGCGACAC CTNCGNCGTG GGCTGCCGTT 
0421 GGGGGGATAG CATTGTGTAC CGGGACGAGA GCTTCGAGGG AAATCCAGAT GGGGATAATC 
0481 CCGCCTACAA CACCGAACTG GG 
 in silico PCR Fragment
0001 ATGCGTCCTG AGCCCACATT CGCGGACAAG AATCCCTCCA AATT-CCGGG ACTACAGTAT 
0061 GGACACCACC GATCCTCTAA AGGAACGTGT GCGCCAGACT TATCGTCAGA TGCATCTGAA 
0121 CCAGACTGTG GATTTCGTCA AGGGTCGTCG TGAGCACTGG CTGAAGTTTA ACACGATTAA 
0181 GATGACTGTG CGCGAAGCTT TGGAGAAGCT GAACGATTTG GTCGACGAAT CGGATCCCGA 
0241 CCTGGATCTG CCTAACATCA TCCACGCCTT CCAGGCTGCT GA-GCGGGCA CGCGCCGAAT 
0301 TTCCGGAGCA CGACTGGCTG CATCTTACGG CGCTCATTCA CGATCTGGGT AAGATCATGG 
0361 CCTTCTACGG CGAGCCGCAG TGGGCGGTGG TTGGCGACAC CTTCGCCGTG GGCTGCCGTT 
0421 GGGGGGATAG CATTGTGTAC CGGGACGAGA GCTTCGAGGG AAATCCAGAT GGGGATAATC 
0481 CCGCCTACAA CACCGAACTG GG 
 Assemble Data

6910R-1.IR_full       1   ATGCGTCCTGAGCCCACATTCGCGGACAAGAATCCCTCCAAATTNCCGGGACTACAGTAT 60
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
6910R-1.in silico     1   ATGCGTCCTGAGCCCACATTCGCGGACAAGAATCCCTCCAAATT-CCGGGACTACAGTAT 60


6910R-1.IR_full       61  GGACACCACCGATCCTCTAAAGGAACGTGTGCGCCAGACTTATCGTCAGATGCATCTGAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6910R-1.in silico     61  GGACACCACCGATCCTCTAAAGGAACGTGTGCGCCAGACTTATCGTCAGATGCATCTGAA 120


6910R-1.IR_full       121 CCAGACTGTGGATTTCGTCAAGGGTCGTCGTGAGCACTGGCTGAAGTTTAACACGATTAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6910R-1.in silico     121 CCAGACTGTGGATTTCGTCAAGGGTCGTCGTGAGCACTGGCTGAAGTTTAACACGATTAA 180


6910R-1.IR_full       181 GATGACTGTGCGCGAAGCTTTGGAGAAGCTGAACGATTTGGTCGACGAATCGGATCCCGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6910R-1.in silico     181 GATGACTGTGCGCGAAGCTTTGGAGAAGCTGAACGATTTGGTCGACGAATCGGATCCCGA 240


6910R-1.IR_full       241 CCTGGATCTGCCTAACATCATCCACGCCTTCCAGGCTGCTGANGCGGGCACGCGCCGAAT 300
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
6910R-1.in silico     241 CCTGGATCTGCCTAACATCATCCACGCCTTCCAGGCTGCTGA-GCGGGCACGCGCCGAAT 300


6910R-1.IR_full       301 TTCCGGAGCACGACTGGCTGCATCTTACGGCGCTCATTCACGATCTGGGTAAGATCATGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6910R-1.in silico     301 TTCCGGAGCACGACTGGCTGCATCTTACGGCGCTCATTCACGATCTGGGTAAGATCATGG 360


6910R-1.IR_full       361 CCTTCTACGGCGAGCCGCAGTGGGCGGTGGTTGGCGACACCTNCGNCGTGGGCTGCCGTT 420
                          |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
6910R-1.in silico     361 CCTTCTACGGCGAGCCGCAGTGGGCGGTGGTTGGCGACACCTTCGCCGTGGGCTGCCGTT 420


6910R-1.IR_full       421 GGGGGGATAGCATTGTGTACCGGGACGAGAGCTTCGAGGGAAATCCAGATGGGGATAATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6910R-1.in silico     421 GGGGGGATAGCATTGTGTACCGGGACGAGAGCTTCGAGGGAAATCCAGATGGGGATAATC 480


6910R-1.IR_full       481 CCGCCTACAACACCGAACTGGG 502
                          ||||||||||||||||||||||
6910R-1.in silico     481 CCGCCTACAACACCGAACTGGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140299.1  CG6910-RA (CG6910), mRNA 
0   NM_135257.1  CG4496-RA (CG4496), mRNA 
0   NM_139714.3  CG10624-RA (sinu), mRNA 
0   NM_140093.1  CG18178-RA (CG18178), mRNA 
0   NM_139969.2  CG7015-RA (Unr), mRNA 
0   NM_168908.1  CG7199-RC, transcript variant C (Hr78), mRNA 
0   NM_168907.1  CG7199-RB, transcript variant B (Hr78), mRNA 
0   NM_079479.3  CG7199-RA, transcript variant A (Hr78), mRNA 
0   NM_206415.1  CG7199-RD, transcript variant D (Hr78), mRNA 
0   NM_132780.1  CG15029-RA (CG15029), mRNA 
0   NM_140985.2  CG4825-RA (CG4825), mRNA 
0   NM_079344.2  CG3836-RA (stwl), mRNA 
0   NM_170534.1  CG1462-RB, transcript variant B (Aph-4), mRNA 
0   NM_169084.1  CG31546-RA (CG31546), mRNA 
0   NM_080356.2  CG5993-RA (os), mRNA 
0   NM_166992.2  CG2904-RA (ec), mRNA 
0   NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_137509.2  CG5482-RA (CG5482), mRNA 
0   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0   NM_138122.2  CG30422-RA (egg), mRNA 
0   NM_142062.1  CG14363-RA (CG14363), mRNA 
0   NM_166709.2  CG30428-RA (CG30428), mRNA 
0   NM_139421.3  CG5687-RA (CG5687), mRNA 
0   NM_165554.2  CG18812-RA, transcript variant A (CG18812), mRNA 
0   NM_165553.2  CG18812-RB, transcript variant B (CG18812), mRNA 
0   NM_165552.2  CG18812-RC, transcript variant C (CG18812), mRNA 
0   NM_137059.2  CG13339-RA (CG13339), mRNA 
0   NM_142913.1  CG10254-RA, transcript variant A (CG10254), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.