National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6906R-2 
 Symbol CAH2  Full Name Carbonic anhydrase 2 
 CG No CG6906  Old CG No CG6906 
 Synonyms CG6906, CT21171, CAH2 
 Accession No (Link to NCBI) NM_140298.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||| ||||||| ||||  | ||||||||||||||||||||||||||||||||||||||| silico     1   AGC-GCCCTGG-ACAA--GGATCACGGCATCGCCGTGATGGCCTTCTTCTTTCAGGTGG- 60

                          || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GC-GACAA-ATCAACTGGTGGCTATGAGGGCTTCACCAACTTGCTCTCCCAGATTGACCG 120

                          |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| silico     121 CAAAGGCAAG-AGCGTTAATATGACCAATCCACTTCCACTGGG-CGAGTACATCTCGAAG 180

                          ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| | silico     181 TCCGTGGAG-AGTTACTTTAGCTACACTGGTTCTCTGACCACACCGCCTTGCAGTGAG-G 240

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGGTCACCTGG-ATTGATTTCACAACGCCCATTGACATCACGGAGAAGCAGTTGAATGCC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTCCGTCTGCTGACAGCCAACGATGATCATCTGAAGAACAATTTCCGACCCATCCAGCCG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTGAACGATCGCACCTTGTACAAGAACTACATAGAAATTCCGATTCACAACATGGGCTCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATTCCACTCGTCGATGCGGAAAATGCGGCTGGCAAGTGGAGGGCACAAGCCGCAGCAGTG 480

                          |||||||||||||||||||||||||||||||| silico     481 CTGTTGCCCCTCGTTGTCCTCGCTGCATTGTC 512

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140298.2  CG6906-RA (CAH2), mRNA 
0   16  83  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_080175.2  CG12242-RA (GstD5), mRNA 
0   NM_143392.2  CG14521-RA (CG14521), mRNA 
0   NM_142769.2  CG5383-RA (PSR), mRNA 
0   NM_167704.1  CG11710-RA, transcript variant A (CG11710), mRNA 
0   NM_134549.2  CG11710-RB, transcript variant B (CG11710), mRNA 
0   NM_080041.2  CG7935-RA (msk), mRNA 
0   NM_001043067.1  CG33141-RB, transcript variant B (sns), mRNA 
0   NM_176106.1  CG33141-RA, transcript variant A (sns), mRNA 
0   NM_144019.1  CG18672-RA (CG18672), mRNA 
0   NM_132829.2  CG9281-RB, transcript variant B (CG9281), mRNA 
0   NM_167458.2  CG9281-RC, transcript variant C (CG9281), mRNA 
0   NM_139661.2  CG7471-RA (Rpd3), mRNA 
0   NM_078731.2  CG3166-RB, transcript variant B (aop), mRNA 
0   NM_164457.1  CG3166-RA, transcript variant A (aop), mRNA 
0   NM_057620.4  CG9073-RA (TpnC47D), mRNA 
0   NM_001032106.1  CG7100-RL, transcript variant L (CadN), mRNA 
0   NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165226.1  CG7100-RF, transcript variant F (CadN), mRNA 
0   NM_165224.1  CG7100-RH, transcript variant H (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 
0   NM_001032107.1  CG7100-RK, transcript variant K (CadN), mRNA 
0   NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
0   12  NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.